Multiple sequence alignment - TraesCS1D01G179100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G179100 chr1D 100.000 2471 0 0 1 2471 254386863 254389333 0 4564
1 TraesCS1D01G179100 chr5D 98.705 2471 29 1 1 2471 503226441 503223974 0 4383
2 TraesCS1D01G179100 chr5D 98.422 2472 35 2 1 2471 503270103 503272571 0 4346
3 TraesCS1D01G179100 chr5D 98.301 2472 39 3 1 2471 503236758 503234289 0 4329
4 TraesCS1D01G179100 chr3A 98.503 2471 33 2 1 2471 66009400 66011866 0 4355
5 TraesCS1D01G179100 chr3B 98.179 2471 44 1 1 2471 201535252 201532783 0 4313
6 TraesCS1D01G179100 chrUn 97.977 2471 45 2 1 2471 216510385 216512850 0 4281
7 TraesCS1D01G179100 chrUn 97.977 2471 45 2 1 2471 286272998 286270533 0 4281
8 TraesCS1D01G179100 chr4D 97.775 2472 48 4 1 2471 177441220 177443685 0 4253
9 TraesCS1D01G179100 chr1B 97.653 2471 51 4 1 2471 633745676 633748139 0 4235


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G179100 chr1D 254386863 254389333 2470 False 4564 4564 100.000 1 2471 1 chr1D.!!$F1 2470
1 TraesCS1D01G179100 chr5D 503223974 503226441 2467 True 4383 4383 98.705 1 2471 1 chr5D.!!$R1 2470
2 TraesCS1D01G179100 chr5D 503270103 503272571 2468 False 4346 4346 98.422 1 2471 1 chr5D.!!$F1 2470
3 TraesCS1D01G179100 chr5D 503234289 503236758 2469 True 4329 4329 98.301 1 2471 1 chr5D.!!$R2 2470
4 TraesCS1D01G179100 chr3A 66009400 66011866 2466 False 4355 4355 98.503 1 2471 1 chr3A.!!$F1 2470
5 TraesCS1D01G179100 chr3B 201532783 201535252 2469 True 4313 4313 98.179 1 2471 1 chr3B.!!$R1 2470
6 TraesCS1D01G179100 chrUn 216510385 216512850 2465 False 4281 4281 97.977 1 2471 1 chrUn.!!$F1 2470
7 TraesCS1D01G179100 chrUn 286270533 286272998 2465 True 4281 4281 97.977 1 2471 1 chrUn.!!$R1 2470
8 TraesCS1D01G179100 chr4D 177441220 177443685 2465 False 4253 4253 97.775 1 2471 1 chr4D.!!$F1 2470
9 TraesCS1D01G179100 chr1B 633745676 633748139 2463 False 4235 4235 97.653 1 2471 1 chr1B.!!$F1 2470

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
385 386 0.250166 AAGGGCGTTCTAGTGCGTTT 60.250 50.0 9.56 0.67 0.0 3.60 F
1265 1267 0.458025 GGATCGACGCGGAAAGTTCT 60.458 55.0 12.47 0.00 0.0 3.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1408 1411 1.674359 TGAGTCGCTTCCTTTTTGCA 58.326 45.000 0.0 0.0 0.0 4.08 R
2399 2403 4.261155 CCGTTCACAATTTCTTGAAGCTCA 60.261 41.667 0.0 0.0 36.2 4.26 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
385 386 0.250166 AAGGGCGTTCTAGTGCGTTT 60.250 50.000 9.56 0.67 0.00 3.60
758 760 2.398588 ACAGGATTTCCGATCCTAGCA 58.601 47.619 7.22 0.00 46.22 3.49
780 782 3.786450 AGGAAAAGGAGGGAAACGGATAT 59.214 43.478 0.00 0.00 0.00 1.63
839 841 9.928618 TCGATCTCATAGATCCCTATAGAATTT 57.071 33.333 10.52 0.00 46.42 1.82
856 858 6.096673 AGAATTTTGTGGAAAGCCGTATTT 57.903 33.333 0.00 0.00 36.79 1.40
859 861 4.920640 TTTGTGGAAAGCCGTATTTGAA 57.079 36.364 0.00 0.00 36.79 2.69
1067 1069 7.266335 CGATCCAATTTTTCGTAATCGATTAGC 59.734 37.037 18.03 11.72 45.65 3.09
1077 1079 7.205737 TCGTAATCGATTAGCTAACATGGTA 57.794 36.000 18.03 0.00 41.35 3.25
1265 1267 0.458025 GGATCGACGCGGAAAGTTCT 60.458 55.000 12.47 0.00 0.00 3.01
1408 1411 2.084930 GGGAGTGGGGGTGCCATAT 61.085 63.158 0.00 0.00 0.00 1.78
1466 1469 6.384224 CAAATAGAGCTCTTGCACATTTTCA 58.616 36.000 23.84 0.00 42.74 2.69
1545 1548 7.796054 TCGGAAAAGAATCAATAGAAGGAGAT 58.204 34.615 0.00 0.00 0.00 2.75
1744 1747 9.040939 CAAAAATCGAAACAATAGGGACTTTTT 57.959 29.630 0.00 0.00 41.75 1.94
1908 1912 5.982890 TTTTGGCCTAATTCTTCTTCTGG 57.017 39.130 3.32 0.00 0.00 3.86
1921 1925 5.982356 TCTTCTTCTGGTGATCGATTCAAT 58.018 37.500 0.00 0.00 35.70 2.57
1935 1939 8.393366 TGATCGATTCAATCTCTGATCAAAAAC 58.607 33.333 11.83 0.00 39.23 2.43
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
423 424 5.291858 TCACATGTTTCTAGCGATTCACATC 59.708 40.000 0.00 0.00 0.00 3.06
470 471 4.732065 TCCAGTCCCCTTACGAAAATTTT 58.268 39.130 2.28 2.28 0.00 1.82
474 475 1.002773 GCTCCAGTCCCCTTACGAAAA 59.997 52.381 0.00 0.00 0.00 2.29
758 760 1.441695 TCCGTTTCCCTCCTTTTCCT 58.558 50.000 0.00 0.00 0.00 3.36
839 841 4.138290 TCTTCAAATACGGCTTTCCACAA 58.862 39.130 0.00 0.00 0.00 3.33
1265 1267 9.973661 TTCCTTGTTTAGATCCTATTTCAATCA 57.026 29.630 0.00 0.00 0.00 2.57
1408 1411 1.674359 TGAGTCGCTTCCTTTTTGCA 58.326 45.000 0.00 0.00 0.00 4.08
1545 1548 4.888038 TTCGAGAAAGATATCGTCCGAA 57.112 40.909 19.43 19.43 40.97 4.30
1608 1611 2.903404 CCTCGAGAGGGCTTAGGTT 58.097 57.895 15.71 0.00 44.87 3.50
1734 1737 4.347607 CATCCAATCTCCAAAAAGTCCCT 58.652 43.478 0.00 0.00 0.00 4.20
1744 1747 5.692115 TTAGTAACTGCATCCAATCTCCA 57.308 39.130 0.00 0.00 0.00 3.86
1908 1912 7.474398 TTTGATCAGAGATTGAATCGATCAC 57.526 36.000 17.83 6.54 39.77 3.06
1921 1925 6.881065 CCAAGGTCTATGTTTTTGATCAGAGA 59.119 38.462 0.00 0.00 30.98 3.10
1935 1939 8.428063 AGAGATGAAATAGAACCAAGGTCTATG 58.572 37.037 3.01 0.00 0.00 2.23
2394 2398 6.906659 TCACAATTTCTTGAAGCTCAATCTC 58.093 36.000 0.00 0.00 35.59 2.75
2399 2403 4.261155 CCGTTCACAATTTCTTGAAGCTCA 60.261 41.667 0.00 0.00 36.20 4.26


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.