Multiple sequence alignment - TraesCS1D01G178800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G178800 chr1D 100.000 2219 0 0 1 2219 254383474 254381256 0 4061
1 TraesCS1D01G178800 chr6D 98.198 2220 18 2 1 2219 389247275 389245077 0 3858
2 TraesCS1D01G178800 chr5D 98.198 2220 18 2 1 2219 503243819 503246017 0 3858
3 TraesCS1D01G178800 chr5D 97.744 1906 21 2 1 1906 503266756 503264873 0 3262
4 TraesCS1D01G178800 chr3D 98.107 2219 19 3 1 2219 589264976 589262781 0 3843
5 TraesCS1D01G178800 chr7B 98.063 2220 21 2 1 2219 663100878 663098680 0 3842
6 TraesCS1D01G178800 chr7B 97.793 2220 27 8 1 2219 662724951 662727149 0 3808
7 TraesCS1D01G178800 chr2A 98.018 2220 22 2 1 2219 726907908 726905710 0 3836
8 TraesCS1D01G178800 chr3A 97.972 2219 24 1 1 2219 66006585 66004388 0 3829
9 TraesCS1D01G178800 chr3B 97.704 2221 28 2 1 2219 201538068 201540267 0 3797
10 TraesCS1D01G178800 chr7D 97.906 1958 20 1 262 2219 231555617 231553681 0 3369
11 TraesCS1D01G178800 chr5B 96.957 986 8 2 1235 2219 127807121 127808085 0 1635
12 TraesCS1D01G178800 chr5B 96.336 655 3 1 1565 2219 127808545 127809178 0 1057
13 TraesCS1D01G178800 chr1B 96.954 985 9 1 1235 2219 638728420 638729383 0 1633
14 TraesCS1D01G178800 chr1B 96.650 985 11 3 1235 2219 135054172 135053210 0 1618


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G178800 chr1D 254381256 254383474 2218 True 4061 4061 100.0000 1 2219 1 chr1D.!!$R1 2218
1 TraesCS1D01G178800 chr6D 389245077 389247275 2198 True 3858 3858 98.1980 1 2219 1 chr6D.!!$R1 2218
2 TraesCS1D01G178800 chr5D 503243819 503246017 2198 False 3858 3858 98.1980 1 2219 1 chr5D.!!$F1 2218
3 TraesCS1D01G178800 chr5D 503264873 503266756 1883 True 3262 3262 97.7440 1 1906 1 chr5D.!!$R1 1905
4 TraesCS1D01G178800 chr3D 589262781 589264976 2195 True 3843 3843 98.1070 1 2219 1 chr3D.!!$R1 2218
5 TraesCS1D01G178800 chr7B 663098680 663100878 2198 True 3842 3842 98.0630 1 2219 1 chr7B.!!$R1 2218
6 TraesCS1D01G178800 chr7B 662724951 662727149 2198 False 3808 3808 97.7930 1 2219 1 chr7B.!!$F1 2218
7 TraesCS1D01G178800 chr2A 726905710 726907908 2198 True 3836 3836 98.0180 1 2219 1 chr2A.!!$R1 2218
8 TraesCS1D01G178800 chr3A 66004388 66006585 2197 True 3829 3829 97.9720 1 2219 1 chr3A.!!$R1 2218
9 TraesCS1D01G178800 chr3B 201538068 201540267 2199 False 3797 3797 97.7040 1 2219 1 chr3B.!!$F1 2218
10 TraesCS1D01G178800 chr7D 231553681 231555617 1936 True 3369 3369 97.9060 262 2219 1 chr7D.!!$R1 1957
11 TraesCS1D01G178800 chr5B 127807121 127809178 2057 False 1346 1635 96.6465 1235 2219 2 chr5B.!!$F1 984
12 TraesCS1D01G178800 chr1B 638728420 638729383 963 False 1633 1633 96.9540 1235 2219 1 chr1B.!!$F1 984
13 TraesCS1D01G178800 chr1B 135053210 135054172 962 True 1618 1618 96.6500 1235 2219 1 chr1B.!!$R1 984

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
252 253 1.072332 ACACGTGCTACAATGGGCA 59.928 52.632 17.22 0.0 36.01 5.36 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2088 3186 2.042435 AAGCCTAGGAGAGCCGCT 60.042 61.111 14.75 0.0 39.96 5.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
252 253 1.072332 ACACGTGCTACAATGGGCA 59.928 52.632 17.22 0.00 36.01 5.36
409 410 2.428187 CGGGCCTTGTACACACCA 59.572 61.111 0.84 0.00 0.00 4.17
714 715 7.450124 TGAGCTTATTATCCTAGGTCGTAAG 57.550 40.000 9.08 13.33 38.81 2.34
1282 1286 4.340097 TCTTCACAGACCAAGAACTACGAA 59.660 41.667 0.00 0.00 0.00 3.85
1326 1330 1.037493 CGGAGGGATCGTACCATTCA 58.963 55.000 0.00 0.00 0.00 2.57
1751 2310 2.985282 CAGCTGCGCCAGGGAAAA 60.985 61.111 4.18 0.00 31.21 2.29
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
252 253 1.218316 GATCGCGACCCTTTGTCCT 59.782 57.895 12.93 0.0 41.18 3.85
409 410 1.063867 AGCTCCTATAGTGTGACGGGT 60.064 52.381 0.00 0.0 0.00 5.28
714 715 8.308207 GGGATCCTATCACTATCAACTAGTTTC 58.692 40.741 12.58 0.0 38.68 2.78
718 719 8.429237 AAAGGGATCCTATCACTATCAACTAG 57.571 38.462 12.58 0.0 43.68 2.57
933 934 3.628942 TGAGCACATTGAACTATCCATGC 59.371 43.478 0.00 0.0 33.15 4.06
1282 1286 3.105959 CCCAGAATGAAAGGGGTGATT 57.894 47.619 0.00 0.0 39.69 2.57
2088 3186 2.042435 AAGCCTAGGAGAGCCGCT 60.042 61.111 14.75 0.0 39.96 5.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.