Multiple sequence alignment - TraesCS1D01G171600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G171600 chr1D 100.000 2432 0 0 1 2432 244768874 244766443 0.000000e+00 4492.0
1 TraesCS1D01G171600 chr1D 96.321 2446 72 11 1 2432 254477394 254474953 0.000000e+00 4002.0
2 TraesCS1D01G171600 chr1D 95.946 2442 84 8 1 2432 244201686 244199250 0.000000e+00 3947.0
3 TraesCS1D01G171600 chr1D 95.041 2420 103 10 26 2432 180356024 180358439 0.000000e+00 3788.0
4 TraesCS1D01G171600 chr1D 95.860 1691 59 6 371 2051 290507190 290505501 0.000000e+00 2724.0
5 TraesCS1D01G171600 chr5D 96.236 2444 77 9 1 2432 6235505 6237945 0.000000e+00 3989.0
6 TraesCS1D01G171600 chr5D 96.496 2397 67 10 50 2432 503331258 503328865 0.000000e+00 3945.0
7 TraesCS1D01G171600 chr1A 96.550 2377 64 11 1 2364 554447550 554449921 0.000000e+00 3919.0
8 TraesCS1D01G171600 chr3B 96.426 2378 67 10 1 2364 201493399 201491026 0.000000e+00 3904.0
9 TraesCS1D01G171600 chr3B 96.859 191 5 1 1 190 201493749 201493559 3.900000e-83 318.0
10 TraesCS1D01G171600 chr3B 95.767 189 6 1 2045 2233 49388534 49388720 1.090000e-78 303.0
11 TraesCS1D01G171600 chr3B 94.271 192 9 2 135 324 430241126 430240935 2.370000e-75 292.0
12 TraesCS1D01G171600 chr3B 98.684 76 1 0 1 76 374245234 374245309 4.220000e-28 135.0
13 TraesCS1D01G171600 chr3B 95.652 69 2 1 316 383 636832265 636832197 2.560000e-20 110.0
14 TraesCS1D01G171600 chr3B 92.647 68 5 0 2365 2432 405424838 405424905 5.530000e-17 99.0
15 TraesCS1D01G171600 chr3B 98.077 52 0 1 11 62 545072737 545072787 3.330000e-14 89.8
16 TraesCS1D01G171600 chr4A 95.344 1761 67 8 681 2432 309374680 309376434 0.000000e+00 2784.0
17 TraesCS1D01G171600 chr3A 94.074 135 6 2 2299 2432 524026790 524026657 1.140000e-48 204.0
18 TraesCS1D01G171600 chr2B 95.146 103 5 0 2330 2432 80543424 80543322 1.930000e-36 163.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G171600 chr1D 244766443 244768874 2431 True 4492 4492 100.0000 1 2432 1 chr1D.!!$R2 2431
1 TraesCS1D01G171600 chr1D 254474953 254477394 2441 True 4002 4002 96.3210 1 2432 1 chr1D.!!$R3 2431
2 TraesCS1D01G171600 chr1D 244199250 244201686 2436 True 3947 3947 95.9460 1 2432 1 chr1D.!!$R1 2431
3 TraesCS1D01G171600 chr1D 180356024 180358439 2415 False 3788 3788 95.0410 26 2432 1 chr1D.!!$F1 2406
4 TraesCS1D01G171600 chr1D 290505501 290507190 1689 True 2724 2724 95.8600 371 2051 1 chr1D.!!$R4 1680
5 TraesCS1D01G171600 chr5D 6235505 6237945 2440 False 3989 3989 96.2360 1 2432 1 chr5D.!!$F1 2431
6 TraesCS1D01G171600 chr5D 503328865 503331258 2393 True 3945 3945 96.4960 50 2432 1 chr5D.!!$R1 2382
7 TraesCS1D01G171600 chr1A 554447550 554449921 2371 False 3919 3919 96.5500 1 2364 1 chr1A.!!$F1 2363
8 TraesCS1D01G171600 chr3B 201491026 201493749 2723 True 2111 3904 96.6425 1 2364 2 chr3B.!!$R3 2363
9 TraesCS1D01G171600 chr4A 309374680 309376434 1754 False 2784 2784 95.3440 681 2432 1 chr4A.!!$F1 1751

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
166 517 2.789409 AGAAAGGGAGTTGGGATTCG 57.211 50.0 0.0 0.0 0.0 3.34 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1833 2198 3.157087 GGCACTTCTCCAAATCCAGAAA 58.843 45.455 0.0 0.0 0.0 2.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
76 77 3.460857 AGAGAAAGCGAGACAAAGTGT 57.539 42.857 0.00 0.00 0.00 3.55
80 81 4.439057 AGAAAGCGAGACAAAGTGTAACA 58.561 39.130 0.00 0.00 41.43 2.41
85 86 5.057149 AGCGAGACAAAGTGTAACAAGAAT 58.943 37.500 0.00 0.00 41.43 2.40
166 517 2.789409 AGAAAGGGAGTTGGGATTCG 57.211 50.000 0.00 0.00 0.00 3.34
330 683 7.287810 ACTAATTTAAGTTCCGCCTATTCCAT 58.712 34.615 0.00 0.00 0.00 3.41
420 774 5.291858 GCAAGCCTTATTCCTATTTTTGCAC 59.708 40.000 0.00 0.00 38.50 4.57
642 998 8.398665 GTGTATCCTTTTTATCGAAGCTTTGAT 58.601 33.333 28.11 28.11 35.52 2.57
898 1260 6.907206 ACCAGTTGTTGTTTCATTGAATTG 57.093 33.333 0.00 0.00 0.00 2.32
985 1348 5.076873 AGGCAAGCAGACCTAATTTAACAA 58.923 37.500 0.00 0.00 33.38 2.83
987 1350 4.851558 GCAAGCAGACCTAATTTAACAACG 59.148 41.667 0.00 0.00 0.00 4.10
994 1357 6.427547 CAGACCTAATTTAACAACGGGTACAA 59.572 38.462 0.00 0.00 0.00 2.41
1188 1551 1.853250 GCCCACCTAAACCAGAGGCT 61.853 60.000 0.00 0.00 37.63 4.58
1319 1682 4.873746 ATGTTAGGCGCAGTACTCATAT 57.126 40.909 10.83 0.00 0.00 1.78
1414 1777 4.781775 TCCAAAAGTTCAGTACCTTCCA 57.218 40.909 0.00 0.00 0.00 3.53
1493 1857 4.488126 TCTTTCAAACTTGCATCCGAAG 57.512 40.909 0.00 0.00 0.00 3.79
1652 2016 1.939511 AGGGGATTGGGATTCCATTGT 59.060 47.619 4.80 0.00 43.63 2.71
1833 2198 6.760291 GGATAATCCTAGAATTCCGTCTGTT 58.240 40.000 0.65 0.00 32.53 3.16
2099 2467 3.058432 GGTTCTTTTCCTAGGTGAAACGC 60.058 47.826 9.08 3.10 38.12 4.84
2103 2471 4.825085 TCTTTTCCTAGGTGAAACGCAATT 59.175 37.500 9.08 0.00 38.12 2.32
2273 2641 0.470766 ACCAGGAACTTTGTACCGCA 59.529 50.000 0.00 0.00 34.60 5.69
2418 2786 8.811994 CACCCCCTTCTTTATCATAAAGAAAAA 58.188 33.333 25.86 10.68 43.28 1.94
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
166 517 8.246180 TGCATCTTCTTTAAAGATTCATCCAAC 58.754 33.333 18.37 4.04 34.96 3.77
254 607 5.366768 TCCAGAACTTCTCTCTTTTCCTCAA 59.633 40.000 0.00 0.00 29.07 3.02
420 774 6.404403 GGGGCTAAAAGTCCTAAAATCGAAAG 60.404 42.308 0.00 0.00 40.65 2.62
642 998 8.637986 ACCAACAACTAAGATAAGCATGAAAAA 58.362 29.630 0.00 0.00 0.00 1.94
898 1260 3.728845 TCGTGAGCCTATTAATGAAGCC 58.271 45.455 0.00 0.00 0.00 4.35
985 1348 6.626302 CCATTTTCATTGTTATTGTACCCGT 58.374 36.000 0.00 0.00 0.00 5.28
987 1350 6.639563 AGCCATTTTCATTGTTATTGTACCC 58.360 36.000 0.00 0.00 0.00 3.69
994 1357 5.522641 AGAGGGAGCCATTTTCATTGTTAT 58.477 37.500 0.00 0.00 0.00 1.89
1103 1466 7.550042 TCCCCAAATAGTACTATAGGAATCCA 58.450 38.462 25.20 9.44 0.00 3.41
1123 1486 6.011981 ACAGGAATTAACTTATCAACTCCCCA 60.012 38.462 0.00 0.00 0.00 4.96
1188 1551 7.065324 CGAAGTTTTGTTAGGGCATCTATAACA 59.935 37.037 0.00 0.00 37.57 2.41
1414 1777 6.194967 CCCCCTCCTAATTCACTAATTTGTT 58.805 40.000 0.00 0.00 36.67 2.83
1833 2198 3.157087 GGCACTTCTCCAAATCCAGAAA 58.843 45.455 0.00 0.00 0.00 2.52
2160 2528 5.457487 GGGGAATCCAAATGAAACCCTTTTT 60.457 40.000 0.09 0.00 40.26 1.94
2273 2641 6.354794 TCCTAGTTGTGCTAAGTAATGTGT 57.645 37.500 0.00 0.00 0.00 3.72


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.