Multiple sequence alignment - TraesCS1D01G171500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G171500 chr1D 100.000 2432 0 0 1 2432 244768352 244765921 0.000000e+00 4492
1 TraesCS1D01G171500 chr1D 95.748 2446 85 10 1 2432 244201163 244198723 0.000000e+00 3923
2 TraesCS1D01G171500 chr1D 96.288 2236 65 10 1 2222 254476869 254474638 0.000000e+00 3653
3 TraesCS1D01G171500 chr1D 95.171 2195 89 10 3 2184 180356525 180358715 0.000000e+00 3450
4 TraesCS1D01G171500 chr5D 96.671 2433 64 9 1 2419 503330782 503328353 0.000000e+00 4028
5 TraesCS1D01G171500 chr5D 96.136 2433 73 11 1 2419 6236029 6238454 0.000000e+00 3952
6 TraesCS1D01G171500 chr4A 95.073 2273 91 12 159 2419 309374680 309376943 0.000000e+00 3557
7 TraesCS1D01G171500 chr2A 94.703 2039 70 16 429 2432 419795652 419793617 0.000000e+00 3133
8 TraesCS1D01G171500 chr2A 95.283 212 7 3 1 210 134517254 134517044 1.390000e-87 333
9 TraesCS1D01G171500 chr2A 90.210 143 13 1 2045 2186 332572786 332572928 4.130000e-43 185
10 TraesCS1D01G171500 chr2A 94.253 87 4 1 2236 2322 740108165 740108080 5.460000e-27 132
11 TraesCS1D01G171500 chr3B 96.494 1854 49 8 1 1842 201492875 201491026 0.000000e+00 3049
12 TraesCS1D01G171500 chr3B 95.754 471 14 3 1965 2432 201491028 201490561 0.000000e+00 754
13 TraesCS1D01G171500 chr3B 93.314 344 12 6 14 347 354951754 354951412 4.670000e-137 497
14 TraesCS1D01G171500 chr3B 95.385 65 3 0 2365 2429 416935373 416935437 1.190000e-18 104
15 TraesCS1D01G171500 chr1A 96.492 1853 49 9 1 1842 554448074 554449921 0.000000e+00 3048


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G171500 chr1D 244765921 244768352 2431 True 4492.0 4492 100.000 1 2432 1 chr1D.!!$R2 2431
1 TraesCS1D01G171500 chr1D 244198723 244201163 2440 True 3923.0 3923 95.748 1 2432 1 chr1D.!!$R1 2431
2 TraesCS1D01G171500 chr1D 254474638 254476869 2231 True 3653.0 3653 96.288 1 2222 1 chr1D.!!$R3 2221
3 TraesCS1D01G171500 chr1D 180356525 180358715 2190 False 3450.0 3450 95.171 3 2184 1 chr1D.!!$F1 2181
4 TraesCS1D01G171500 chr5D 503328353 503330782 2429 True 4028.0 4028 96.671 1 2419 1 chr5D.!!$R1 2418
5 TraesCS1D01G171500 chr5D 6236029 6238454 2425 False 3952.0 3952 96.136 1 2419 1 chr5D.!!$F1 2418
6 TraesCS1D01G171500 chr4A 309374680 309376943 2263 False 3557.0 3557 95.073 159 2419 1 chr4A.!!$F1 2260
7 TraesCS1D01G171500 chr2A 419793617 419795652 2035 True 3133.0 3133 94.703 429 2432 1 chr2A.!!$R2 2003
8 TraesCS1D01G171500 chr3B 201490561 201492875 2314 True 1901.5 3049 96.124 1 2432 2 chr3B.!!$R2 2431
9 TraesCS1D01G171500 chr1A 554448074 554449921 1847 False 3048.0 3048 96.492 1 1842 1 chr1A.!!$F1 1841

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
666 675 1.85325 GCCCACCTAAACCAGAGGCT 61.853 60.0 0.0 0.0 37.63 4.58 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2065 2087 2.878406 CCTCGTGTCACCAGTTCAAATT 59.122 45.455 0.0 0.0 0.0 1.82 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
120 122 8.398665 GTGTATCCTTTTTATCGAAGCTTTGAT 58.601 33.333 28.11 28.11 35.52 2.57
376 384 6.907206 ACCAGTTGTTGTTTCATTGAATTG 57.093 33.333 0.00 0.00 0.00 2.32
463 472 5.076873 AGGCAAGCAGACCTAATTTAACAA 58.923 37.500 0.00 0.00 33.38 2.83
465 474 4.851558 GCAAGCAGACCTAATTTAACAACG 59.148 41.667 0.00 0.00 0.00 4.10
472 481 6.427547 CAGACCTAATTTAACAACGGGTACAA 59.572 38.462 0.00 0.00 0.00 2.41
660 669 2.438795 GGCTGCCCACCTAAACCA 59.561 61.111 7.66 0.00 0.00 3.67
666 675 1.853250 GCCCACCTAAACCAGAGGCT 61.853 60.000 0.00 0.00 37.63 4.58
736 745 5.766150 AGTTGAGGATCGAACTCTATCTG 57.234 43.478 17.84 0.00 38.61 2.90
892 901 4.781775 TCCAAAAGTTCAGTACCTTCCA 57.218 40.909 0.00 0.00 0.00 3.53
971 983 4.488126 TCTTTCAAACTTGCATCCGAAG 57.512 40.909 0.00 0.00 0.00 3.79
1130 1142 1.939511 AGGGGATTGGGATTCCATTGT 59.060 47.619 4.80 0.00 43.63 2.71
1311 1326 6.760291 GGATAATCCTAGAATTCCGTCTGTT 58.240 40.000 0.65 0.00 32.53 3.16
1577 1595 3.058432 GGTTCTTTTCCTAGGTGAAACGC 60.058 47.826 9.08 3.10 38.12 4.84
1581 1599 4.825085 TCTTTTCCTAGGTGAAACGCAATT 59.175 37.500 9.08 0.00 38.12 2.32
1751 1769 0.470766 ACCAGGAACTTTGTACCGCA 59.529 50.000 0.00 0.00 34.60 5.69
1896 1915 8.811994 CACCCCCTTCTTTATCATAAAGAAAAA 58.188 33.333 25.86 10.68 43.28 1.94
2065 2087 2.746279 TTTTCTCTGCCAGGAACCAA 57.254 45.000 0.00 0.00 0.00 3.67
2304 2352 5.304101 AGTGAATAACCAACATTTCTTGCCA 59.696 36.000 0.00 0.00 0.00 4.92
2315 2363 7.703621 CCAACATTTCTTGCCAATACTCTAATG 59.296 37.037 0.00 0.00 0.00 1.90
2393 2442 7.907214 TCCTTTGTGAAAGAGTAGAATAAGC 57.093 36.000 0.00 0.00 41.02 3.09
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
120 122 8.637986 ACCAACAACTAAGATAAGCATGAAAAA 58.362 29.630 0.00 0.00 0.00 1.94
376 384 3.728845 TCGTGAGCCTATTAATGAAGCC 58.271 45.455 0.00 0.00 0.00 4.35
463 472 6.626302 CCATTTTCATTGTTATTGTACCCGT 58.374 36.000 0.00 0.00 0.00 5.28
465 474 6.639563 AGCCATTTTCATTGTTATTGTACCC 58.360 36.000 0.00 0.00 0.00 3.69
472 481 5.522641 AGAGGGAGCCATTTTCATTGTTAT 58.477 37.500 0.00 0.00 0.00 1.89
581 590 7.550042 TCCCCAAATAGTACTATAGGAATCCA 58.450 38.462 25.20 9.44 0.00 3.41
601 610 6.011981 ACAGGAATTAACTTATCAACTCCCCA 60.012 38.462 0.00 0.00 0.00 4.96
660 669 2.983296 AGGGCATCTATAACAGCCTCT 58.017 47.619 0.00 0.00 46.23 3.69
666 675 7.065324 CGAAGTTTTGTTAGGGCATCTATAACA 59.935 37.037 0.00 0.00 37.57 2.41
892 901 6.194967 CCCCCTCCTAATTCACTAATTTGTT 58.805 40.000 0.00 0.00 36.67 2.83
1311 1326 3.157087 GGCACTTCTCCAAATCCAGAAA 58.843 45.455 0.00 0.00 0.00 2.52
1751 1769 6.354794 TCCTAGTTGTGCTAAGTAATGTGT 57.645 37.500 0.00 0.00 0.00 3.72
1999 2019 6.496911 TGATCCAAATACCTCGAGATGGATTA 59.503 38.462 24.28 20.54 45.21 1.75
2065 2087 2.878406 CCTCGTGTCACCAGTTCAAATT 59.122 45.455 0.00 0.00 0.00 1.82
2359 2408 4.761739 TCTTTCACAAAGGAATGCGAAGAT 59.238 37.500 0.00 0.00 39.01 2.40
2393 2442 8.469200 TCAATGGGTTTAAGATTCATTAGCTTG 58.531 33.333 0.00 0.00 0.00 4.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.