Multiple sequence alignment - TraesCS1D01G170600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G170600 chr1D 100.000 2381 0 0 1 2381 244419982 244422362 0.000000e+00 4397
1 TraesCS1D01G170600 chr1D 97.481 2382 53 7 1 2381 244404450 244406825 0.000000e+00 4060
2 TraesCS1D01G170600 chr1D 96.601 2383 60 11 1 2381 244398012 244400375 0.000000e+00 3932
3 TraesCS1D01G170600 chr5D 95.108 2412 82 15 1 2381 483799768 483797362 0.000000e+00 3768
4 TraesCS1D01G170600 chr5D 94.539 2399 94 17 1 2368 6211857 6209465 0.000000e+00 3670
5 TraesCS1D01G170600 chr1A 94.830 2418 85 18 1 2381 554469240 554466826 0.000000e+00 3736
6 TraesCS1D01G170600 chr3B 94.789 2418 83 21 1 2381 201502363 201504774 0.000000e+00 3727
7 TraesCS1D01G170600 chr3B 95.789 1591 53 9 1 1578 10274535 10276124 0.000000e+00 2555
8 TraesCS1D01G170600 chr1B 94.470 1971 77 16 1 1941 633724856 633726824 0.000000e+00 3007
9 TraesCS1D01G170600 chr3D 94.994 1658 63 14 1 1640 21893097 21894752 0.000000e+00 2584
10 TraesCS1D01G170600 chr3D 92.900 1000 43 9 1408 2381 21894763 21895760 0.000000e+00 1428
11 TraesCS1D01G170600 chr6D 95.901 1537 51 8 1 1526 431395346 431393811 0.000000e+00 2479
12 TraesCS1D01G170600 chr6D 95.222 586 20 3 1798 2381 431397647 431398226 0.000000e+00 920
13 TraesCS1D01G170600 chr5A 93.170 1142 50 8 1266 2381 684322666 684323805 0.000000e+00 1652
14 TraesCS1D01G170600 chr2A 92.904 916 43 7 1486 2381 276443796 276442883 0.000000e+00 1312
15 TraesCS1D01G170600 chr2A 91.579 475 20 7 1483 1937 588082865 588083339 2.580000e-179 638
16 TraesCS1D01G170600 chr2D 94.103 814 30 5 1584 2381 628283062 628283873 0.000000e+00 1221


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G170600 chr1D 244419982 244422362 2380 False 4397 4397 100.000 1 2381 1 chr1D.!!$F3 2380
1 TraesCS1D01G170600 chr1D 244404450 244406825 2375 False 4060 4060 97.481 1 2381 1 chr1D.!!$F2 2380
2 TraesCS1D01G170600 chr1D 244398012 244400375 2363 False 3932 3932 96.601 1 2381 1 chr1D.!!$F1 2380
3 TraesCS1D01G170600 chr5D 483797362 483799768 2406 True 3768 3768 95.108 1 2381 1 chr5D.!!$R2 2380
4 TraesCS1D01G170600 chr5D 6209465 6211857 2392 True 3670 3670 94.539 1 2368 1 chr5D.!!$R1 2367
5 TraesCS1D01G170600 chr1A 554466826 554469240 2414 True 3736 3736 94.830 1 2381 1 chr1A.!!$R1 2380
6 TraesCS1D01G170600 chr3B 201502363 201504774 2411 False 3727 3727 94.789 1 2381 1 chr3B.!!$F2 2380
7 TraesCS1D01G170600 chr3B 10274535 10276124 1589 False 2555 2555 95.789 1 1578 1 chr3B.!!$F1 1577
8 TraesCS1D01G170600 chr1B 633724856 633726824 1968 False 3007 3007 94.470 1 1941 1 chr1B.!!$F1 1940
9 TraesCS1D01G170600 chr3D 21893097 21895760 2663 False 2006 2584 93.947 1 2381 2 chr3D.!!$F1 2380
10 TraesCS1D01G170600 chr6D 431393811 431395346 1535 True 2479 2479 95.901 1 1526 1 chr6D.!!$R1 1525
11 TraesCS1D01G170600 chr6D 431397647 431398226 579 False 920 920 95.222 1798 2381 1 chr6D.!!$F1 583
12 TraesCS1D01G170600 chr5A 684322666 684323805 1139 False 1652 1652 93.170 1266 2381 1 chr5A.!!$F1 1115
13 TraesCS1D01G170600 chr2A 276442883 276443796 913 True 1312 1312 92.904 1486 2381 1 chr2A.!!$R1 895
14 TraesCS1D01G170600 chr2D 628283062 628283873 811 False 1221 1221 94.103 1584 2381 1 chr2D.!!$F1 797

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
85 93 0.565674 TTTTCCTTGGGGGCCTCTTT 59.434 50.0 4.32 0.0 34.39 2.52 F
564 577 1.094785 AACGATTTTGGATGGGCTCG 58.905 50.0 0.00 0.0 0.00 5.03 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1239 1257 0.331278 CAGCCCCTACATTCAACCCA 59.669 55.0 0.0 0.0 0.0 4.51 R
2041 2354 2.489938 ATTGTTCTCGCCTTTGCCTA 57.510 45.0 0.0 0.0 0.0 3.93 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
79 87 0.885879 CGTACTTTTTCCTTGGGGGC 59.114 55.000 0.00 0.00 34.39 5.80
85 93 0.565674 TTTTCCTTGGGGGCCTCTTT 59.434 50.000 4.32 0.00 34.39 2.52
111 119 9.567776 TCTCATTTAACAAATGTCTGGAACTTA 57.432 29.630 10.51 0.00 46.46 2.24
149 157 4.016444 GGAATACCAGGCAATCTGAAACA 58.984 43.478 0.00 0.00 46.18 2.83
564 577 1.094785 AACGATTTTGGATGGGCTCG 58.905 50.000 0.00 0.00 0.00 5.03
718 733 8.411683 GTGAAGCATAAATTCATTTGATCTCCT 58.588 33.333 0.00 0.00 38.81 3.69
1436 1455 2.092323 GTCTTTCCCATTCTTTCCCCG 58.908 52.381 0.00 0.00 0.00 5.73
1441 1460 0.550914 CCCATTCTTTCCCCGGATCA 59.449 55.000 0.73 0.00 0.00 2.92
1542 1562 7.071196 TCCTGATGGTAGCAAGAGTAACAATAT 59.929 37.037 0.00 0.00 34.23 1.28
1657 1940 6.313905 GCCAAGTGATTGATATTATACCTCCG 59.686 42.308 0.00 0.00 0.00 4.63
1658 1941 7.611770 CCAAGTGATTGATATTATACCTCCGA 58.388 38.462 0.00 0.00 0.00 4.55
1893 2203 0.107848 AGGTCCCGGCATTTCTTACG 60.108 55.000 0.00 0.00 0.00 3.18
1914 2224 6.144078 ACGATCAAGTTGGTAAAAAGCTTT 57.856 33.333 5.69 5.69 0.00 3.51
2041 2354 4.021916 CCCATGCAAAAGAAGAGAATCCT 58.978 43.478 0.00 0.00 33.66 3.24
2065 2378 3.673338 GGCAAAGGCGAGAACAATAAAAC 59.327 43.478 0.00 0.00 42.47 2.43
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
251 259 4.964593 TCCTGTAGGAGGTTTTTGTACAC 58.035 43.478 0.00 0.00 43.37 2.90
564 577 8.850452 CAAAAATAGTGAAAATAAGCTCGTTCC 58.150 33.333 0.00 0.00 0.00 3.62
1076 1093 3.214328 ACAATTCGTCCAGTTGCTTCTT 58.786 40.909 0.00 0.00 0.00 2.52
1239 1257 0.331278 CAGCCCCTACATTCAACCCA 59.669 55.000 0.00 0.00 0.00 4.51
1436 1455 4.084118 GCATCTTTCTTCGTAGCATGATCC 60.084 45.833 0.00 0.00 0.00 3.36
1441 1460 4.128925 TGAGCATCTTTCTTCGTAGCAT 57.871 40.909 0.00 0.00 34.92 3.79
1499 1519 5.661503 TCAGGATAGATCTGTCCTCTTCT 57.338 43.478 32.00 13.60 46.49 2.85
1542 1562 6.544931 ACCTGTTGACGTAGCATTATAGACTA 59.455 38.462 0.00 0.00 0.00 2.59
1657 1940 5.360591 TCTGAAACAAGAAGTTCTGGTCTC 58.639 41.667 13.44 9.94 40.26 3.36
1658 1941 5.359194 TCTGAAACAAGAAGTTCTGGTCT 57.641 39.130 13.44 0.00 40.26 3.85
1893 2203 8.593492 AATCAAAGCTTTTTACCAACTTGATC 57.407 30.769 9.53 0.00 0.00 2.92
2041 2354 2.489938 ATTGTTCTCGCCTTTGCCTA 57.510 45.000 0.00 0.00 0.00 3.93
2178 2491 9.765795 ATAGTAATCTTTGACGAATTAGGAAGG 57.234 33.333 0.00 0.00 0.00 3.46


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.