Multiple sequence alignment - TraesCS1D01G170300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G170300 chr1D 100.000 2120 0 0 1 2120 244402188 244400069 0.000000e+00 3916.0
1 TraesCS1D01G170300 chr1D 98.680 2122 25 3 1 2120 244408639 244406519 0.000000e+00 3760.0
2 TraesCS1D01G170300 chr1D 97.116 1907 53 2 216 2120 244423961 244422055 0.000000e+00 3216.0
3 TraesCS1D01G170300 chr1D 95.495 1887 71 8 247 2120 254489477 254487592 0.000000e+00 3001.0
4 TraesCS1D01G170300 chr1D 97.297 222 3 3 1 220 322727132 322726912 7.140000e-100 374.0
5 TraesCS1D01G170300 chr2D 96.444 1884 57 6 245 2120 628285447 628283566 0.000000e+00 3099.0
6 TraesCS1D01G170300 chr6D 95.714 1890 63 8 245 2120 431399808 431397923 0.000000e+00 3025.0
7 TraesCS1D01G170300 chr6D 97.297 222 4 2 1 220 265530430 265530209 1.990000e-100 375.0
8 TraesCS1D01G170300 chr6D 100.000 33 0 0 216 248 135672687 135672719 6.320000e-06 62.1
9 TraesCS1D01G170300 chr3D 95.334 1886 73 9 245 2118 21897337 21895455 0.000000e+00 2981.0
10 TraesCS1D01G170300 chr3D 97.297 222 4 2 1 220 33236451 33236230 1.990000e-100 375.0
11 TraesCS1D01G170300 chr3D 100.000 31 0 0 216 246 296380011 296379981 8.170000e-05 58.4
12 TraesCS1D01G170300 chr3B 95.047 1898 70 11 245 2120 201506357 201504462 0.000000e+00 2963.0
13 TraesCS1D01G170300 chr2A 94.849 1883 86 7 245 2120 335826057 335824179 0.000000e+00 2929.0
14 TraesCS1D01G170300 chr5A 94.321 1884 84 8 245 2120 684325366 684323498 0.000000e+00 2865.0
15 TraesCS1D01G170300 chr1A 95.985 1644 56 7 245 1882 256026389 256028028 0.000000e+00 2662.0
16 TraesCS1D01G170300 chr4D 97.309 223 5 1 1 222 30362620 30362842 5.520000e-101 377.0
17 TraesCS1D01G170300 chr7B 97.297 222 5 1 1 221 526388427 526388648 1.990000e-100 375.0
18 TraesCS1D01G170300 chr1B 96.875 224 5 2 1 222 16341952 16342175 7.140000e-100 374.0
19 TraesCS1D01G170300 chr4B 96.429 224 6 2 1 222 647700309 647700532 3.320000e-98 368.0
20 TraesCS1D01G170300 chr7D 94.872 234 11 1 1 234 634501859 634501627 4.300000e-97 364.0
21 TraesCS1D01G170300 chr7A 100.000 34 0 0 216 249 190688279 190688312 1.760000e-06 63.9
22 TraesCS1D01G170300 chr6B 100.000 33 0 0 216 248 558520078 558520110 6.320000e-06 62.1
23 TraesCS1D01G170300 chr3A 100.000 30 0 0 217 246 296254735 296254764 2.940000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G170300 chr1D 244400069 244402188 2119 True 3916 3916 100.000 1 2120 1 chr1D.!!$R1 2119
1 TraesCS1D01G170300 chr1D 244406519 244408639 2120 True 3760 3760 98.680 1 2120 1 chr1D.!!$R2 2119
2 TraesCS1D01G170300 chr1D 244422055 244423961 1906 True 3216 3216 97.116 216 2120 1 chr1D.!!$R3 1904
3 TraesCS1D01G170300 chr1D 254487592 254489477 1885 True 3001 3001 95.495 247 2120 1 chr1D.!!$R4 1873
4 TraesCS1D01G170300 chr2D 628283566 628285447 1881 True 3099 3099 96.444 245 2120 1 chr2D.!!$R1 1875
5 TraesCS1D01G170300 chr6D 431397923 431399808 1885 True 3025 3025 95.714 245 2120 1 chr6D.!!$R2 1875
6 TraesCS1D01G170300 chr3D 21895455 21897337 1882 True 2981 2981 95.334 245 2118 1 chr3D.!!$R1 1873
7 TraesCS1D01G170300 chr3B 201504462 201506357 1895 True 2963 2963 95.047 245 2120 1 chr3B.!!$R1 1875
8 TraesCS1D01G170300 chr2A 335824179 335826057 1878 True 2929 2929 94.849 245 2120 1 chr2A.!!$R1 1875
9 TraesCS1D01G170300 chr5A 684323498 684325366 1868 True 2865 2865 94.321 245 2120 1 chr5A.!!$R1 1875
10 TraesCS1D01G170300 chr1A 256026389 256028028 1639 False 2662 2662 95.985 245 1882 1 chr1A.!!$F1 1637

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
40 41 4.582656 CCACAGTTTGACCAGATTTAACCA 59.417 41.667 0.0 0.0 0.0 3.67 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1378 1404 2.104111 CCAGTAGTATCGGCCATTTCCA 59.896 50.0 2.24 0.0 0.0 3.53 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
36 37 5.042463 TGACCACAGTTTGACCAGATTTA 57.958 39.130 0.00 0.00 0.00 1.40
40 41 4.582656 CCACAGTTTGACCAGATTTAACCA 59.417 41.667 0.00 0.00 0.00 3.67
942 965 9.220767 GACAAGGAATTCTGTTAATAACTGACT 57.779 33.333 11.44 4.96 38.78 3.41
1304 1330 8.555729 AGAATTCTCTTATCTCATTTGGAAGGT 58.444 33.333 0.88 0.00 0.00 3.50
1378 1404 7.496346 TTGATAGAATGTGGAGGAAAGTAGT 57.504 36.000 0.00 0.00 0.00 2.73
1402 1428 4.448210 GAAATGGCCGATACTACTGGAAA 58.552 43.478 0.00 0.00 0.00 3.13
1949 1999 4.753610 ACCTCGACTAAACCTAAGCAAAAC 59.246 41.667 0.00 0.00 0.00 2.43
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
9 10 4.080807 TCTGGTCAAACTGTGGTCAAACTA 60.081 41.667 0.00 0.00 0.00 2.24
140 141 4.130857 GGGGCTTTTAAGATCTAGAGTGC 58.869 47.826 0.00 0.00 0.00 4.40
787 810 4.171754 GCTATGAATAACCCGGTATCGAC 58.828 47.826 0.00 0.00 39.00 4.20
942 965 8.203937 TCGAGTTGTTCTAAAGAATCAAAACA 57.796 30.769 0.00 0.00 36.33 2.83
1304 1330 9.656323 AGTCATGAGTAGTTATAAGGATGGTAA 57.344 33.333 0.00 0.00 0.00 2.85
1378 1404 2.104111 CCAGTAGTATCGGCCATTTCCA 59.896 50.000 2.24 0.00 0.00 3.53
1402 1428 7.406104 AGTACCTATCAGCCAAAGAGAAATTT 58.594 34.615 0.00 0.00 0.00 1.82
1780 1806 7.941919 AGTAAACTCTTCCATTGAAGGTTTTC 58.058 34.615 20.69 17.58 46.61 2.29
1949 1999 4.513318 GTCTGTCTCTTGGACCTCTTTTTG 59.487 45.833 0.00 0.00 43.89 2.44


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.