Multiple sequence alignment - TraesCS1D01G170200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G170200 chr1D 100.000 2111 0 0 1 2111 244395853 244397963 0.000000e+00 3899.0
1 TraesCS1D01G170200 chr1D 96.878 2114 40 11 1 2111 244402311 244404401 0.000000e+00 3515.0
2 TraesCS1D01G170200 chr1D 95.822 1101 39 6 676 1774 254483753 254484848 0.000000e+00 1772.0
3 TraesCS1D01G170200 chr1D 94.512 656 23 5 3 652 244408764 244409412 0.000000e+00 1000.0
4 TraesCS1D01G170200 chr1D 95.015 341 14 2 1774 2111 254485125 254485465 1.110000e-147 532.0
5 TraesCS1D01G170200 chr5D 96.196 1104 36 5 676 1777 6217417 6216318 0.000000e+00 1801.0
6 TraesCS1D01G170200 chr5D 95.575 339 13 1 1775 2111 483800155 483799817 1.840000e-150 542.0
7 TraesCS1D01G170200 chr5D 94.721 341 14 2 1775 2111 6214353 6214693 5.160000e-146 527.0
8 TraesCS1D01G170200 chr6D 96.105 1104 35 7 676 1777 431397122 431396025 0.000000e+00 1794.0
9 TraesCS1D01G170200 chr6D 96.632 475 14 2 1 475 373917624 373918096 0.000000e+00 787.0
10 TraesCS1D01G170200 chr2D 96.185 1101 35 6 676 1774 643860127 643861222 0.000000e+00 1794.0
11 TraesCS1D01G170200 chr2D 98.529 476 5 2 1 475 454348785 454349259 0.000000e+00 839.0
12 TraesCS1D01G170200 chr2D 96.451 479 12 2 1 475 36805099 36804622 0.000000e+00 785.0
13 TraesCS1D01G170200 chr2D 96.033 479 18 1 1 478 69802574 69802096 0.000000e+00 778.0
14 TraesCS1D01G170200 chr6A 96.496 1056 32 5 475 1527 192822805 192823858 0.000000e+00 1740.0
15 TraesCS1D01G170200 chr1A 96.360 934 29 4 846 1777 554470851 554469921 0.000000e+00 1531.0
16 TraesCS1D01G170200 chr3B 96.440 927 28 4 850 1774 201500761 201501684 0.000000e+00 1524.0
17 TraesCS1D01G170200 chr3B 95.549 337 14 1 1775 2111 201501963 201502298 2.380000e-149 538.0
18 TraesCS1D01G170200 chr3B 91.282 195 16 1 476 669 386604652 386604458 4.470000e-67 265.0
19 TraesCS1D01G170200 chrUn 96.091 921 31 4 856 1774 444441717 444442634 0.000000e+00 1496.0
20 TraesCS1D01G170200 chrUn 95.280 339 14 2 1775 2111 465336125 465335787 8.570000e-149 536.0
21 TraesCS1D01G170200 chrUn 95.266 338 15 1 1775 2111 414887475 414887812 3.080000e-148 534.0
22 TraesCS1D01G170200 chrUn 95.770 331 12 1 1775 2103 357608349 357608019 1.110000e-147 532.0
23 TraesCS1D01G170200 chr3A 95.918 588 22 2 473 1059 393236757 393236171 0.000000e+00 952.0
24 TraesCS1D01G170200 chr4D 97.694 477 9 2 1 475 410165070 410165546 0.000000e+00 819.0
25 TraesCS1D01G170200 chr4D 95.349 43 1 1 512 553 182819242 182819200 1.350000e-07 67.6
26 TraesCS1D01G170200 chr7D 96.646 477 14 2 1 475 55954027 55954503 0.000000e+00 791.0
27 TraesCS1D01G170200 chr7D 96.421 475 15 1 1 475 214669438 214668966 0.000000e+00 782.0
28 TraesCS1D01G170200 chr7D 96.234 478 15 2 1 475 482663069 482663546 0.000000e+00 780.0
29 TraesCS1D01G170200 chr3D 96.444 478 13 4 1 475 30439130 30438654 0.000000e+00 785.0
30 TraesCS1D01G170200 chr3D 94.257 296 16 1 475 769 213385332 213385627 3.190000e-123 451.0
31 TraesCS1D01G170200 chr2A 96.579 380 11 2 585 963 588082488 588082866 1.370000e-176 628.0
32 TraesCS1D01G170200 chr5A 90.780 141 12 1 495 634 267848602 267848462 9.940000e-44 187.0
33 TraesCS1D01G170200 chr2B 93.069 101 6 1 478 577 454928241 454928341 1.690000e-31 147.0
34 TraesCS1D01G170200 chr7A 97.222 36 1 0 625 660 493484063 493484028 6.290000e-06 62.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G170200 chr1D 244395853 244397963 2110 False 3899 3899 100.0000 1 2111 1 chr1D.!!$F1 2110
1 TraesCS1D01G170200 chr1D 244402311 244404401 2090 False 3515 3515 96.8780 1 2111 1 chr1D.!!$F2 2110
2 TraesCS1D01G170200 chr1D 254483753 254485465 1712 False 1152 1772 95.4185 676 2111 2 chr1D.!!$F4 1435
3 TraesCS1D01G170200 chr1D 244408764 244409412 648 False 1000 1000 94.5120 3 652 1 chr1D.!!$F3 649
4 TraesCS1D01G170200 chr5D 6216318 6217417 1099 True 1801 1801 96.1960 676 1777 1 chr5D.!!$R1 1101
5 TraesCS1D01G170200 chr6D 431396025 431397122 1097 True 1794 1794 96.1050 676 1777 1 chr6D.!!$R1 1101
6 TraesCS1D01G170200 chr2D 643860127 643861222 1095 False 1794 1794 96.1850 676 1774 1 chr2D.!!$F2 1098
7 TraesCS1D01G170200 chr6A 192822805 192823858 1053 False 1740 1740 96.4960 475 1527 1 chr6A.!!$F1 1052
8 TraesCS1D01G170200 chr1A 554469921 554470851 930 True 1531 1531 96.3600 846 1777 1 chr1A.!!$R1 931
9 TraesCS1D01G170200 chr3B 201500761 201502298 1537 False 1031 1524 95.9945 850 2111 2 chr3B.!!$F1 1261
10 TraesCS1D01G170200 chrUn 444441717 444442634 917 False 1496 1496 96.0910 856 1774 1 chrUn.!!$F2 918
11 TraesCS1D01G170200 chr3A 393236171 393236757 586 True 952 952 95.9180 473 1059 1 chr3A.!!$R1 586

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
503 510 0.905337 ACTAACAGGGCTTCGCTCCT 60.905 55.0 0.0 0.0 31.3 3.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1635 1651 4.051922 GCGATTCCGTAGAAAGACATCAT 58.948 43.478 0.0 0.0 35.09 2.45 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
66 67 2.037251 CAGACTTGGAAACGAGGGAGAA 59.963 50.000 0.00 0.0 46.96 2.87
85 86 4.767478 AGAATAGAACCCGGAAGTTAAGC 58.233 43.478 0.73 0.0 0.00 3.09
164 165 4.915809 TGGAATGATGAGGGGTGATTAGAT 59.084 41.667 0.00 0.0 0.00 1.98
193 194 5.999044 AGGATAAATTGAGCAGTGATGAGT 58.001 37.500 0.00 0.0 0.00 3.41
328 334 1.221021 CGGGACTAAAGGTGGAGCC 59.779 63.158 0.00 0.0 37.58 4.70
501 508 2.165845 TCTTACTAACAGGGCTTCGCTC 59.834 50.000 0.00 0.0 0.00 5.03
503 510 0.905337 ACTAACAGGGCTTCGCTCCT 60.905 55.000 0.00 0.0 31.30 3.69
518 525 1.754555 GCTCCTCGGGATAGGTCTTCA 60.755 57.143 0.00 0.0 37.91 3.02
629 637 9.610104 TCTATAGTAGGTAAGATAATTTGCCCA 57.390 33.333 0.00 0.0 33.78 5.36
1344 1358 9.751542 CTATTATTTCACAGGAGTACTAGTTGG 57.248 37.037 0.00 0.0 0.00 3.77
1682 1698 4.020662 AGCCTATGCATTAGCTCCTACTTC 60.021 45.833 15.34 0.0 42.74 3.01
1684 1700 5.719173 CCTATGCATTAGCTCCTACTTCTC 58.281 45.833 3.54 0.0 42.74 2.87
1700 1716 8.525316 TCCTACTTCTCGTGTAATATTTTGTGA 58.475 33.333 0.00 0.0 0.00 3.58
1817 2111 6.007485 AGGAAGTCCCTTCTAAATTGGATC 57.993 41.667 4.18 0.0 44.85 3.36
1884 2178 6.796705 ACGAACGAGGATAACAGAAATTTT 57.203 33.333 0.14 0.0 0.00 1.82
1931 2228 8.406297 GTGAGGTATATCGCATACTATTCATCA 58.594 37.037 0.00 0.0 0.00 3.07
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
66 67 2.498885 ACGCTTAACTTCCGGGTTCTAT 59.501 45.455 0.00 0.0 0.00 1.98
164 165 9.716531 CATCACTGCTCAATTTATCCTCTAATA 57.283 33.333 0.00 0.0 0.00 0.98
193 194 7.921041 AACCTCTAATCTCTAATCATCACCA 57.079 36.000 0.00 0.0 0.00 4.17
345 351 2.890311 TCTTACACGAACCGGGACTAAA 59.110 45.455 6.32 0.0 32.98 1.85
346 352 2.513753 TCTTACACGAACCGGGACTAA 58.486 47.619 6.32 0.0 32.98 2.24
347 353 2.198827 TCTTACACGAACCGGGACTA 57.801 50.000 6.32 0.0 32.98 2.59
348 354 1.000171 GTTCTTACACGAACCGGGACT 60.000 52.381 6.32 0.0 37.82 3.85
349 355 1.422388 GTTCTTACACGAACCGGGAC 58.578 55.000 6.32 0.0 37.82 4.46
350 356 3.892200 GTTCTTACACGAACCGGGA 57.108 52.632 6.32 0.0 37.82 5.14
501 508 1.542030 CGATGAAGACCTATCCCGAGG 59.458 57.143 0.00 0.0 42.89 4.63
503 510 2.651382 TCGATGAAGACCTATCCCGA 57.349 50.000 0.00 0.0 0.00 5.14
518 525 2.677037 CGGGTGGAGTTAGCTTTTCGAT 60.677 50.000 0.00 0.0 0.00 3.59
1344 1358 4.685169 TTGATTCTGAAATCGCCTTCAC 57.315 40.909 0.00 0.0 43.61 3.18
1449 1463 6.384015 AGTTCTACCCATATGTGTTCTGATCA 59.616 38.462 1.24 0.0 0.00 2.92
1626 1642 5.243954 CGTAGAAAGACATCATGATCCCCTA 59.756 44.000 4.86 0.0 0.00 3.53
1635 1651 4.051922 GCGATTCCGTAGAAAGACATCAT 58.948 43.478 0.00 0.0 35.09 2.45
1682 1698 9.702726 CCTACATTTCACAAAATATTACACGAG 57.297 33.333 0.00 0.0 33.27 4.18
1700 1716 5.422970 TCGGTCATAACCACTACCTACATTT 59.577 40.000 0.00 0.0 46.86 2.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.