Multiple sequence alignment - TraesCS1D01G169800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G169800 chr1D 100.000 2366 0 0 1 2366 244201615 244199250 0 4370
1 TraesCS1D01G169800 chr1D 96.121 2372 85 5 1 2366 254477323 254474953 0 3864
2 TraesCS1D01G169800 chr1D 95.867 2371 83 8 1 2366 244768803 244766443 0 3821
3 TraesCS1D01G169800 chr1D 95.023 2371 112 4 1 2366 180356070 180358439 0 3720
4 TraesCS1D01G169800 chr5D 96.332 2372 81 4 1 2366 503331236 503328865 0 3893
5 TraesCS1D01G169800 chr5D 96.076 2370 89 3 1 2366 6235576 6237945 0 3858
6 TraesCS1D01G169800 chr1A 96.526 2303 73 6 1 2298 554447621 554449921 0 3803
7 TraesCS1D01G169800 chr3B 96.224 2304 80 4 1 2298 201493328 201491026 0 3766
8 TraesCS1D01G169800 chr2D 96.331 1717 57 3 587 2298 33929969 33931684 0 2817
9 TraesCS1D01G169800 chr4A 94.997 1759 81 5 611 2366 309374680 309376434 0 2754
10 TraesCS1D01G169800 chrUn 97.079 582 16 1 1 581 465171787 465171206 0 979


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G169800 chr1D 244199250 244201615 2365 True 4370 4370 100.000 1 2366 1 chr1D.!!$R1 2365
1 TraesCS1D01G169800 chr1D 254474953 254477323 2370 True 3864 3864 96.121 1 2366 1 chr1D.!!$R3 2365
2 TraesCS1D01G169800 chr1D 244766443 244768803 2360 True 3821 3821 95.867 1 2366 1 chr1D.!!$R2 2365
3 TraesCS1D01G169800 chr1D 180356070 180358439 2369 False 3720 3720 95.023 1 2366 1 chr1D.!!$F1 2365
4 TraesCS1D01G169800 chr5D 503328865 503331236 2371 True 3893 3893 96.332 1 2366 1 chr5D.!!$R1 2365
5 TraesCS1D01G169800 chr5D 6235576 6237945 2369 False 3858 3858 96.076 1 2366 1 chr5D.!!$F1 2365
6 TraesCS1D01G169800 chr1A 554447621 554449921 2300 False 3803 3803 96.526 1 2298 1 chr1A.!!$F1 2297
7 TraesCS1D01G169800 chr3B 201491026 201493328 2302 True 3766 3766 96.224 1 2298 1 chr3B.!!$R1 2297
8 TraesCS1D01G169800 chr2D 33929969 33931684 1715 False 2817 2817 96.331 587 2298 1 chr2D.!!$F1 1711
9 TraesCS1D01G169800 chr4A 309374680 309376434 1754 False 2754 2754 94.997 611 2366 1 chr4A.!!$F1 1755
10 TraesCS1D01G169800 chrUn 465171206 465171787 581 True 979 979 97.079 1 581 1 chrUn.!!$R1 580

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
378 381 1.955451 TTAGGACTTTTAGCCCCGGA 58.045 50.0 0.73 0.0 0.0 5.14 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1463 1472 1.938625 AACCAACACTGTTGCATTGC 58.061 45.0 15.42 0.46 0.0 3.56 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
149 150 5.763698 ACAGAGGAAACAAAGGCTAAACTAC 59.236 40.000 0.00 0.00 0.00 2.73
214 216 9.892130 GGAAAAGAGAGAAGTTCTGGATAAATA 57.108 33.333 10.90 0.00 35.87 1.40
271 273 4.141287 CGCCTATTCCACATTAATGGGAA 58.859 43.478 26.85 26.85 40.49 3.97
378 381 1.955451 TTAGGACTTTTAGCCCCGGA 58.045 50.000 0.73 0.00 0.00 5.14
478 482 6.721571 ATACGCTATTATATGTTTGCGCTT 57.278 33.333 9.73 0.00 46.03 4.68
566 570 5.430007 TGGGTGTATCCGTTTTTATCGAAT 58.570 37.500 0.00 0.00 37.00 3.34
634 639 2.416027 GCGAAAAGGAGCCTTGGAATTC 60.416 50.000 1.91 0.00 36.26 2.17
778 786 7.452880 AATGATCTTTCGAATTGGTCAAGAA 57.547 32.000 15.40 0.00 0.00 2.52
786 794 4.222810 TCGAATTGGTCAAGAATCTCCAGA 59.777 41.667 0.00 0.00 0.00 3.86
987 995 2.680577 GAGCAAATGCCTGAACCAAAG 58.319 47.619 0.94 0.00 43.38 2.77
990 998 3.640967 AGCAAATGCCTGAACCAAAGTAA 59.359 39.130 0.94 0.00 43.38 2.24
1183 1191 7.700638 TCGCGAGAAATAGTTGAGGATCGAC 62.701 48.000 3.71 0.00 43.70 4.20
1255 1263 3.193903 TGTTAGGCGCAGTACTCATACAA 59.806 43.478 10.83 0.00 33.30 2.41
1391 1400 4.200092 GGGGGCTATTTTGTGTAGAAGAG 58.800 47.826 0.00 0.00 0.00 2.85
1425 1434 4.562143 GGCAATCTTTCAAACTTGCATCCT 60.562 41.667 12.50 0.00 44.41 3.24
1463 1472 3.710209 ACAAAGAGGGAGACATGAAGG 57.290 47.619 0.00 0.00 0.00 3.46
1471 1480 1.820519 GGAGACATGAAGGCAATGCAA 59.179 47.619 7.79 0.00 0.00 4.08
1475 1484 1.965643 ACATGAAGGCAATGCAACAGT 59.034 42.857 7.79 0.00 0.00 3.55
1599 1608 5.987347 GGGATTCCATTGCTGTCATTTTATG 59.013 40.000 4.80 0.00 0.00 1.90
1655 1664 3.056107 TGCTTATGATATAGCACCCGGTC 60.056 47.826 0.00 0.00 42.12 4.79
1672 1681 2.652795 GGTCGATCTTTAGCTAGCGTC 58.347 52.381 9.55 1.60 0.00 5.19
1836 1845 7.579940 ATGATATGGTGGGAATCTCTTATGT 57.420 36.000 0.00 0.00 0.00 2.29
1846 1855 7.939039 GTGGGAATCTCTTATGTTAATCATCCA 59.061 37.037 0.00 0.00 37.91 3.41
1896 1905 0.327095 TGGATAGGCTGGCCCTTACA 60.327 55.000 8.11 0.16 43.06 2.41
2005 2014 6.151817 ACTCCAGATTTTATTCAAGTCAAGGC 59.848 38.462 0.00 0.00 0.00 4.35
2023 2032 9.528489 AGTCAAGGCATATTTTTAGGTTCTTTA 57.472 29.630 0.00 0.00 0.00 1.85
2036 2045 9.683870 TTTTAGGTTCTTTAACTAGGTGAAACA 57.316 29.630 0.00 0.00 35.38 2.83
2118 2131 4.535526 AAGGGTTTCATTTGGATTTCCG 57.464 40.909 0.00 0.00 39.43 4.30
2168 2181 9.466497 TTCCTTCATATGAACAGAAAAATAGCT 57.534 29.630 14.23 0.00 0.00 3.32
2352 2365 8.981659 CACCCCCTTCTTTATCATAAAGAAAAT 58.018 33.333 25.86 12.04 43.28 1.82
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
214 216 6.585695 AGTCAATTCAATTCAGCATTGTCT 57.414 33.333 0.00 0.00 42.79 3.41
271 273 7.609760 TTCGTGAAGCAGAAACATAATGTAT 57.390 32.000 0.00 0.00 0.00 2.29
378 381 3.718723 AGCTTCTCTGGTCCTTCACTAT 58.281 45.455 0.00 0.00 0.00 2.12
478 482 5.240891 TCCACATCAAAAGCAACAAAAACA 58.759 33.333 0.00 0.00 0.00 2.83
786 794 3.527937 ACCGTATAGAAGGGGCCATAAT 58.472 45.455 4.39 0.00 37.45 1.28
1376 1385 8.352942 CCTGCTTTTTACTCTTCTACACAAAAT 58.647 33.333 0.00 0.00 0.00 1.82
1389 1398 4.790765 AAGATTGCCCTGCTTTTTACTC 57.209 40.909 0.00 0.00 0.00 2.59
1391 1400 4.881920 TGAAAGATTGCCCTGCTTTTTAC 58.118 39.130 0.00 0.00 32.45 2.01
1463 1472 1.938625 AACCAACACTGTTGCATTGC 58.061 45.000 15.42 0.46 0.00 3.56
1471 1480 5.570320 AGCCAAATAGATAACCAACACTGT 58.430 37.500 0.00 0.00 0.00 3.55
1475 1484 6.953101 TGACTAGCCAAATAGATAACCAACA 58.047 36.000 0.00 0.00 0.00 3.33
1655 1664 5.284428 TGATAGACGCTAGCTAAAGATCG 57.716 43.478 13.93 0.00 0.00 3.69
1836 1845 4.255301 ACGTTTAAGGCGTGGATGATTAA 58.745 39.130 6.40 0.00 41.33 1.40
1846 1855 3.805971 GCATTAGGATACGTTTAAGGCGT 59.194 43.478 0.00 11.00 45.11 5.68
1976 1985 8.099364 TGACTTGAATAAAATCTGGAGTTGTC 57.901 34.615 0.00 0.00 0.00 3.18
2070 2079 8.939201 TTTCTCAGTCTATCTAGAATGCTTTG 57.061 34.615 9.26 0.00 45.19 2.77
2167 2180 6.516718 TGGTAGAGAACTTCTTTGAGTCAAG 58.483 40.000 5.56 0.00 37.36 3.02
2168 2181 6.463049 CCTGGTAGAGAACTTCTTTGAGTCAA 60.463 42.308 0.08 0.08 37.36 3.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.