Multiple sequence alignment - TraesCS1D01G167700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G167700 chr1D 100.000 2336 0 0 1 2336 239622688 239620353 0.000000e+00 4314
1 TraesCS1D01G167700 chr1D 97.502 1481 20 3 856 2336 212525835 212527298 0.000000e+00 2514
2 TraesCS1D01G167700 chr4D 97.068 2353 40 3 1 2336 93450274 93447934 0.000000e+00 3936
3 TraesCS1D01G167700 chr4D 86.730 422 31 10 1717 2113 390273821 390274242 1.650000e-121 446
4 TraesCS1D01G167700 chr2D 95.076 2356 76 18 1 2336 118532899 118535234 0.000000e+00 3672
5 TraesCS1D01G167700 chr2D 81.746 126 19 4 3 126 11559692 11559815 4.110000e-18 102
6 TraesCS1D01G167700 chr4B 94.726 2370 87 12 1 2336 339264496 339262131 0.000000e+00 3650
7 TraesCS1D01G167700 chr4B 85.383 431 29 11 1717 2113 480059725 480060155 1.290000e-112 416
8 TraesCS1D01G167700 chr3B 96.742 1197 31 4 1 1189 809806074 809807270 0.000000e+00 1988
9 TraesCS1D01G167700 chr3B 94.048 336 10 1 2011 2336 809807372 809807707 3.470000e-138 501
10 TraesCS1D01G167700 chr3A 96.839 1044 26 4 223 1259 431134968 431136011 0.000000e+00 1738
11 TraesCS1D01G167700 chr3A 93.785 1062 41 12 1293 2336 431136012 431137066 0.000000e+00 1572
12 TraesCS1D01G167700 chr3A 95.706 163 6 1 1 163 431134796 431134957 6.400000e-66 261
13 TraesCS1D01G167700 chr7B 93.321 1123 46 12 1235 2336 375392208 375393322 0.000000e+00 1631
14 TraesCS1D01G167700 chr5B 87.777 1399 113 22 151 1496 537784769 537783376 0.000000e+00 1583
15 TraesCS1D01G167700 chr5A 87.616 1405 113 23 149 1496 558176235 558174835 0.000000e+00 1574
16 TraesCS1D01G167700 chr5D 87.779 1391 111 25 160 1496 441405476 441404091 0.000000e+00 1572
17 TraesCS1D01G167700 chr5D 78.632 468 46 20 1524 1955 472427107 472427556 6.400000e-66 261
18 TraesCS1D01G167700 chr4A 81.633 686 53 30 1497 2113 72026458 72027139 3.470000e-138 501
19 TraesCS1D01G167700 chr1A 84.211 133 18 2 6 137 33018986 33018856 2.440000e-25 126


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G167700 chr1D 239620353 239622688 2335 True 4314.000000 4314 100.000000 1 2336 1 chr1D.!!$R1 2335
1 TraesCS1D01G167700 chr1D 212525835 212527298 1463 False 2514.000000 2514 97.502000 856 2336 1 chr1D.!!$F1 1480
2 TraesCS1D01G167700 chr4D 93447934 93450274 2340 True 3936.000000 3936 97.068000 1 2336 1 chr4D.!!$R1 2335
3 TraesCS1D01G167700 chr2D 118532899 118535234 2335 False 3672.000000 3672 95.076000 1 2336 1 chr2D.!!$F2 2335
4 TraesCS1D01G167700 chr4B 339262131 339264496 2365 True 3650.000000 3650 94.726000 1 2336 1 chr4B.!!$R1 2335
5 TraesCS1D01G167700 chr3B 809806074 809807707 1633 False 1244.500000 1988 95.395000 1 2336 2 chr3B.!!$F1 2335
6 TraesCS1D01G167700 chr3A 431134796 431137066 2270 False 1190.333333 1738 95.443333 1 2336 3 chr3A.!!$F1 2335
7 TraesCS1D01G167700 chr7B 375392208 375393322 1114 False 1631.000000 1631 93.321000 1235 2336 1 chr7B.!!$F1 1101
8 TraesCS1D01G167700 chr5B 537783376 537784769 1393 True 1583.000000 1583 87.777000 151 1496 1 chr5B.!!$R1 1345
9 TraesCS1D01G167700 chr5A 558174835 558176235 1400 True 1574.000000 1574 87.616000 149 1496 1 chr5A.!!$R1 1347
10 TraesCS1D01G167700 chr5D 441404091 441405476 1385 True 1572.000000 1572 87.779000 160 1496 1 chr5D.!!$R1 1336
11 TraesCS1D01G167700 chr4A 72026458 72027139 681 False 501.000000 501 81.633000 1497 2113 1 chr4A.!!$F1 616

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
526 560 1.60984 GCGTCGAGAAGCATATCCGC 61.61 60.0 6.16 0.0 35.86 5.54 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1715 1837 0.178301 TAGTTGCACGTGAACACCCA 59.822 50.0 22.23 3.06 0.0 4.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
193 194 4.063967 CACGACGCCCTGGCTGTA 62.064 66.667 6.60 0.0 39.32 2.74
217 218 3.833645 CGGGGATCGAGGCGAACA 61.834 66.667 0.00 0.0 39.99 3.18
526 560 1.609840 GCGTCGAGAAGCATATCCGC 61.610 60.000 6.16 0.0 35.86 5.54
1051 1089 2.112279 TAGAAGGGACAAGGTGGTGT 57.888 50.000 0.00 0.0 0.00 4.16
1648 1739 4.069232 CAAGCTCGCCCTCGACCA 62.069 66.667 0.00 0.0 40.21 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1596 1684 1.737793 GTTGGATGCCTCGTTGTTAGG 59.262 52.381 0.00 0.00 37.17 2.69
1715 1837 0.178301 TAGTTGCACGTGAACACCCA 59.822 50.000 22.23 3.06 0.00 4.51
2132 2302 4.443266 GCTCCTCGTCGGCTTGCT 62.443 66.667 0.00 0.00 0.00 3.91
2167 2337 3.134623 TCGTGGCTGTCAAAGGATATCAT 59.865 43.478 4.83 0.00 0.00 2.45


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.