Multiple sequence alignment - TraesCS1D01G158400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G158400 chr1D 100.000 4508 0 0 1 4508 223174958 223170451 0.000000e+00 8325.0
1 TraesCS1D01G158400 chr1D 91.228 57 3 2 3827 3882 367413278 367413223 4.840000e-10 76.8
2 TraesCS1D01G158400 chr7D 99.136 4514 29 6 1 4508 617975776 617971267 0.000000e+00 8111.0
3 TraesCS1D01G158400 chr7D 91.237 194 12 4 295 486 629623521 629623711 4.470000e-65 259.0
4 TraesCS1D01G158400 chr1B 93.820 3382 103 48 487 3829 322487010 322483696 0.000000e+00 4990.0
5 TraesCS1D01G158400 chr1B 91.587 630 46 4 3879 4508 322483694 322483072 0.000000e+00 863.0
6 TraesCS1D01G158400 chr1B 89.591 269 24 2 1 267 322487708 322487442 5.590000e-89 339.0
7 TraesCS1D01G158400 chr1B 92.473 186 12 2 303 487 239055657 239055841 9.620000e-67 265.0
8 TraesCS1D01G158400 chr1A 93.045 3393 117 38 487 3829 290205389 290202066 0.000000e+00 4848.0
9 TraesCS1D01G158400 chr1A 95.714 630 22 4 3879 4508 290202064 290201440 0.000000e+00 1009.0
10 TraesCS1D01G158400 chr1A 90.164 305 25 2 1 305 290205680 290205381 4.230000e-105 392.0
11 TraesCS1D01G158400 chrUn 100.000 387 0 0 3517 3903 480384373 480383987 0.000000e+00 715.0
12 TraesCS1D01G158400 chrUn 91.710 193 11 3 306 495 87864814 87864624 3.460000e-66 263.0
13 TraesCS1D01G158400 chr4D 93.085 188 9 3 303 488 35722300 35722485 5.750000e-69 272.0
14 TraesCS1D01G158400 chr4B 92.553 188 11 3 302 487 159604570 159604384 2.670000e-67 267.0
15 TraesCS1D01G158400 chr7B 92.473 186 12 2 303 487 551415126 551415310 9.620000e-67 265.0
16 TraesCS1D01G158400 chr4A 90.594 202 16 3 296 495 619148257 619148457 9.620000e-67 265.0
17 TraesCS1D01G158400 chr2D 91.371 197 12 4 301 495 537187727 537187920 9.620000e-67 265.0
18 TraesCS1D01G158400 chr3A 94.444 54 3 0 3828 3881 576690830 576690777 2.890000e-12 84.2
19 TraesCS1D01G158400 chr6A 92.593 54 4 0 3828 3881 6610798 6610851 1.340000e-10 78.7
20 TraesCS1D01G158400 chr6A 91.071 56 4 1 3827 3882 565047984 565047930 1.740000e-09 75.0
21 TraesCS1D01G158400 chr7A 91.071 56 4 1 3827 3882 191838686 191838632 1.740000e-09 75.0
22 TraesCS1D01G158400 chr2B 91.071 56 4 1 3827 3882 4922329 4922383 1.740000e-09 75.0
23 TraesCS1D01G158400 chr5D 90.909 55 4 1 3827 3881 179264320 179264267 6.260000e-09 73.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G158400 chr1D 223170451 223174958 4507 True 8325 8325 100.000000 1 4508 1 chr1D.!!$R1 4507
1 TraesCS1D01G158400 chr7D 617971267 617975776 4509 True 8111 8111 99.136000 1 4508 1 chr7D.!!$R1 4507
2 TraesCS1D01G158400 chr1B 322483072 322487708 4636 True 2064 4990 91.666000 1 4508 3 chr1B.!!$R1 4507
3 TraesCS1D01G158400 chr1A 290201440 290205680 4240 True 2083 4848 92.974333 1 4508 3 chr1A.!!$R1 4507

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
865 1280 3.434453 CCCTATATCAACGCCCCAAGAAA 60.434 47.826 0.00 0.00 0.0 2.52 F
1026 1445 1.353103 CATGGACGCGCTCATTTCC 59.647 57.895 5.73 4.88 0.0 3.13 F
1054 1473 4.497984 ACAACGCCACCACAGCCA 62.498 61.111 0.00 0.00 0.0 4.75 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2934 3382 7.363431 AGTTTTGTACAAGCAAGATAAAGAGC 58.637 34.615 8.56 0.0 0.00 4.09 R
3013 3469 3.165071 TGATGTGCTCTGACCTACTCAA 58.835 45.455 0.00 0.0 0.00 3.02 R
3515 3979 1.255667 GGGAACACCAGACGAGGCTA 61.256 60.000 0.00 0.0 39.85 3.93 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
211 217 3.924686 CCTTATTTACTAGTATGCGGCGG 59.075 47.826 9.78 0.00 0.00 6.13
495 904 8.352942 GTGAATTAGACAAACTGAACCAGAAAT 58.647 33.333 0.45 0.00 35.18 2.17
626 1041 7.275920 AGAGATAAAGTAGCCGAAACATGAAT 58.724 34.615 0.00 0.00 0.00 2.57
865 1280 3.434453 CCCTATATCAACGCCCCAAGAAA 60.434 47.826 0.00 0.00 0.00 2.52
1026 1445 1.353103 CATGGACGCGCTCATTTCC 59.647 57.895 5.73 4.88 0.00 3.13
1054 1473 4.497984 ACAACGCCACCACAGCCA 62.498 61.111 0.00 0.00 0.00 4.75
3013 3469 6.039415 TCACCTAACCTTATCTACCTGGAT 57.961 41.667 0.00 0.00 0.00 3.41
3269 3733 4.373116 GCGGTGGCTCAAGGACGA 62.373 66.667 0.00 0.00 35.83 4.20
3515 3979 1.251251 GCCAAGCTCTGAACCACATT 58.749 50.000 0.00 0.00 0.00 2.71
4432 4925 2.758979 AGTTGGTACTACCTCCATGTCG 59.241 50.000 6.79 0.00 39.58 4.35
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
211 217 5.518812 TGTTCAAAGTGTATCACAATGCAC 58.481 37.500 0.00 0.0 45.68 4.57
432 841 5.753721 AAGGATATCACATCTAAGCTCCC 57.246 43.478 4.83 0.0 0.00 4.30
462 871 9.424319 GTTCAGTTTGTCTAATTCACATCTAGA 57.576 33.333 0.00 0.0 0.00 2.43
495 904 1.428448 CTTCGAGATTTGTGCCACGA 58.572 50.000 0.00 0.0 0.00 4.35
843 1258 1.697432 TCTTGGGGCGTTGATATAGGG 59.303 52.381 0.00 0.0 0.00 3.53
865 1280 3.165071 GGAATGTGTGATTTTGGAGGGT 58.835 45.455 0.00 0.0 0.00 4.34
915 1330 0.384230 GCGTGTATGTGTGTGTGTGC 60.384 55.000 0.00 0.0 0.00 4.57
2934 3382 7.363431 AGTTTTGTACAAGCAAGATAAAGAGC 58.637 34.615 8.56 0.0 0.00 4.09
3013 3469 3.165071 TGATGTGCTCTGACCTACTCAA 58.835 45.455 0.00 0.0 0.00 3.02
3515 3979 1.255667 GGGAACACCAGACGAGGCTA 61.256 60.000 0.00 0.0 39.85 3.93
4097 4590 6.331369 CCATCTGGTTTTACATCACTGTTT 57.669 37.500 0.00 0.0 36.79 2.83
4432 4925 9.697250 TTCGATGTCGTAATGAACATAAATTTC 57.303 29.630 0.00 0.0 40.80 2.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.