Multiple sequence alignment - TraesCS1D01G152900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G152900 chr1D 100.000 2314 0 0 1 2314 212458839 212461152 0.000000e+00 4274
1 TraesCS1D01G152900 chr7D 99.093 2315 20 1 1 2314 626630213 626632527 0.000000e+00 4157
2 TraesCS1D01G152900 chr7D 99.093 2315 19 2 1 2314 626724465 626726778 0.000000e+00 4157
3 TraesCS1D01G152900 chr7D 99.007 2316 21 2 1 2314 382073379 382071064 0.000000e+00 4148
4 TraesCS1D01G152900 chr4D 98.531 2315 32 2 1 2314 123545918 123543605 0.000000e+00 4085
5 TraesCS1D01G152900 chr4D 98.229 2315 39 2 1 2314 123388256 123385943 0.000000e+00 4047
6 TraesCS1D01G152900 chr3D 98.489 2316 32 3 1 2314 602873032 602875346 0.000000e+00 4080
7 TraesCS1D01G152900 chr3D 99.000 100 1 0 2215 2314 572093126 572093027 1.830000e-41 180
8 TraesCS1D01G152900 chrUn 99.062 2238 19 2 1 2237 170995032 170992796 0.000000e+00 4015
9 TraesCS1D01G152900 chr7B 99.017 2238 21 1 1 2237 644446412 644448649 0.000000e+00 4010
10 TraesCS1D01G152900 chr7B 99.017 2238 21 1 1 2237 743095875 743098112 0.000000e+00 4010
11 TraesCS1D01G152900 chr6B 100.000 90 0 0 2225 2314 394408748 394408659 1.420000e-37 167


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G152900 chr1D 212458839 212461152 2313 False 4274 4274 100.000 1 2314 1 chr1D.!!$F1 2313
1 TraesCS1D01G152900 chr7D 626630213 626632527 2314 False 4157 4157 99.093 1 2314 1 chr7D.!!$F1 2313
2 TraesCS1D01G152900 chr7D 626724465 626726778 2313 False 4157 4157 99.093 1 2314 1 chr7D.!!$F2 2313
3 TraesCS1D01G152900 chr7D 382071064 382073379 2315 True 4148 4148 99.007 1 2314 1 chr7D.!!$R1 2313
4 TraesCS1D01G152900 chr4D 123543605 123545918 2313 True 4085 4085 98.531 1 2314 1 chr4D.!!$R2 2313
5 TraesCS1D01G152900 chr4D 123385943 123388256 2313 True 4047 4047 98.229 1 2314 1 chr4D.!!$R1 2313
6 TraesCS1D01G152900 chr3D 602873032 602875346 2314 False 4080 4080 98.489 1 2314 1 chr3D.!!$F1 2313
7 TraesCS1D01G152900 chrUn 170992796 170995032 2236 True 4015 4015 99.062 1 2237 1 chrUn.!!$R1 2236
8 TraesCS1D01G152900 chr7B 644446412 644448649 2237 False 4010 4010 99.017 1 2237 1 chr7B.!!$F1 2236
9 TraesCS1D01G152900 chr7B 743095875 743098112 2237 False 4010 4010 99.017 1 2237 1 chr7B.!!$F2 2236

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
739 740 1.343465 GTATAGGTATGGCGTGCAGGT 59.657 52.381 8.4 0.0 0.0 4.0 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1844 1849 0.179225 CTGTTATGCACCAACGACGC 60.179 55.0 8.13 0.0 0.0 5.19 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
66 67 4.453751 AGCACAAGCAAAAATGGTTGAAT 58.546 34.783 22.88 8.75 46.59 2.57
739 740 1.343465 GTATAGGTATGGCGTGCAGGT 59.657 52.381 8.40 0.00 0.00 4.00
1161 1164 2.499685 CCCCTCGATTCCCGACAC 59.500 66.667 0.00 0.00 43.23 3.67
1260 1263 4.832823 TCTATCTACTCGGCAATTCATCCA 59.167 41.667 0.00 0.00 0.00 3.41
1408 1411 5.830912 AGATCAAAGAAAATGAAACGCACA 58.169 33.333 0.00 0.00 0.00 4.57
1604 1609 7.374491 GCATATAAGCACTTTCGACTTGATTTC 59.626 37.037 0.00 0.00 0.00 2.17
1667 1672 8.158025 TCTTCAGAGTCCTTTTATCCCAATAA 57.842 34.615 0.00 0.00 0.00 1.40
1844 1849 4.163649 ACGATAAAGGTAAAGAGAAGGGGG 59.836 45.833 0.00 0.00 0.00 5.40
1961 1966 6.745474 GCCAATAGACCTTGAATAGCCTGTAT 60.745 42.308 0.00 0.00 0.00 2.29
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
739 740 2.242196 CCTAAAATCCAAGGGAGGCTGA 59.758 50.000 0.00 0.0 34.05 4.26
1260 1263 2.023414 TTGGCGACCGTGAAGTCACT 62.023 55.000 9.63 0.0 44.34 3.41
1343 1346 0.900647 AGTCGCACTGGGAGCTAGTT 60.901 55.000 0.00 0.0 0.00 2.24
1390 1393 4.507388 CACCATGTGCGTTTCATTTTCTTT 59.493 37.500 0.00 0.0 0.00 2.52
1408 1411 3.496160 GGAACCGCTATAATGACCACCAT 60.496 47.826 0.00 0.0 36.99 3.55
1604 1609 1.148310 CTTGCGTAACTGACCACTGG 58.852 55.000 0.00 0.0 0.00 4.00
1667 1672 4.814224 AAGGCCCACACATTATCCTTAT 57.186 40.909 0.00 0.0 32.66 1.73
1844 1849 0.179225 CTGTTATGCACCAACGACGC 60.179 55.000 8.13 0.0 0.00 5.19
1961 1966 9.793259 AGTAAATCCTCTTCACAAGTTATTTCA 57.207 29.630 0.00 0.0 0.00 2.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.