Multiple sequence alignment - TraesCS1D01G150500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G150500 chr1D 100.000 3119 0 0 1 3119 208399288 208396170 0 5760
1 TraesCS1D01G150500 chr1D 95.244 2481 81 6 671 3119 227730619 227733094 0 3893
2 TraesCS1D01G150500 chr1B 92.642 1658 73 12 671 2284 327360289 327361941 0 2340
3 TraesCS1D01G150500 chr1A 92.678 1639 73 23 671 2272 295225090 295223462 0 2318
4 TraesCS1D01G150500 chr6B 94.519 675 28 5 1 673 286751844 286751177 0 1033
5 TraesCS1D01G150500 chrUn 94.362 674 33 2 1 673 30344375 30343706 0 1029
6 TraesCS1D01G150500 chr3B 94.354 673 30 4 1 671 773136716 773137382 0 1026
7 TraesCS1D01G150500 chr3B 94.083 676 32 5 1 672 760401075 760400404 0 1020
8 TraesCS1D01G150500 chr3A 94.205 673 33 5 1 671 712730500 712731168 0 1022
9 TraesCS1D01G150500 chr7B 94.065 674 33 3 1 671 716137059 716137728 0 1016
10 TraesCS1D01G150500 chr7B 93.033 689 38 6 1 687 374712135 374712815 0 998
11 TraesCS1D01G150500 chr5D 94.048 672 32 4 1 670 168013621 168014286 0 1013
12 TraesCS1D01G150500 chr5D 89.489 666 61 6 2442 3105 242378165 242378823 0 833
13 TraesCS1D01G150500 chr2B 93.750 672 36 3 1 671 448586943 448586277 0 1003
14 TraesCS1D01G150500 chr4B 88.376 671 67 8 2439 3105 358895589 358894926 0 797
15 TraesCS1D01G150500 chr2D 89.580 595 46 10 2439 3031 226527940 226528520 0 741
16 TraesCS1D01G150500 chr6D 85.865 665 85 4 2442 3104 462399065 462398408 0 699
17 TraesCS1D01G150500 chr6D 85.542 664 88 3 2442 3104 452071366 452070710 0 688
18 TraesCS1D01G150500 chr6D 87.348 577 65 4 2442 3017 55435147 55434578 0 654
19 TraesCS1D01G150500 chr3D 85.714 665 85 6 2442 3104 177014761 177014105 0 693
20 TraesCS1D01G150500 chr2A 87.858 593 61 8 2442 3031 271914331 271913747 0 686


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G150500 chr1D 208396170 208399288 3118 True 5760 5760 100.000 1 3119 1 chr1D.!!$R1 3118
1 TraesCS1D01G150500 chr1D 227730619 227733094 2475 False 3893 3893 95.244 671 3119 1 chr1D.!!$F1 2448
2 TraesCS1D01G150500 chr1B 327360289 327361941 1652 False 2340 2340 92.642 671 2284 1 chr1B.!!$F1 1613
3 TraesCS1D01G150500 chr1A 295223462 295225090 1628 True 2318 2318 92.678 671 2272 1 chr1A.!!$R1 1601
4 TraesCS1D01G150500 chr6B 286751177 286751844 667 True 1033 1033 94.519 1 673 1 chr6B.!!$R1 672
5 TraesCS1D01G150500 chrUn 30343706 30344375 669 True 1029 1029 94.362 1 673 1 chrUn.!!$R1 672
6 TraesCS1D01G150500 chr3B 773136716 773137382 666 False 1026 1026 94.354 1 671 1 chr3B.!!$F1 670
7 TraesCS1D01G150500 chr3B 760400404 760401075 671 True 1020 1020 94.083 1 672 1 chr3B.!!$R1 671
8 TraesCS1D01G150500 chr3A 712730500 712731168 668 False 1022 1022 94.205 1 671 1 chr3A.!!$F1 670
9 TraesCS1D01G150500 chr7B 716137059 716137728 669 False 1016 1016 94.065 1 671 1 chr7B.!!$F2 670
10 TraesCS1D01G150500 chr7B 374712135 374712815 680 False 998 998 93.033 1 687 1 chr7B.!!$F1 686
11 TraesCS1D01G150500 chr5D 168013621 168014286 665 False 1013 1013 94.048 1 670 1 chr5D.!!$F1 669
12 TraesCS1D01G150500 chr5D 242378165 242378823 658 False 833 833 89.489 2442 3105 1 chr5D.!!$F2 663
13 TraesCS1D01G150500 chr2B 448586277 448586943 666 True 1003 1003 93.750 1 671 1 chr2B.!!$R1 670
14 TraesCS1D01G150500 chr4B 358894926 358895589 663 True 797 797 88.376 2439 3105 1 chr4B.!!$R1 666
15 TraesCS1D01G150500 chr2D 226527940 226528520 580 False 741 741 89.580 2439 3031 1 chr2D.!!$F1 592
16 TraesCS1D01G150500 chr6D 462398408 462399065 657 True 699 699 85.865 2442 3104 1 chr6D.!!$R3 662
17 TraesCS1D01G150500 chr6D 452070710 452071366 656 True 688 688 85.542 2442 3104 1 chr6D.!!$R2 662
18 TraesCS1D01G150500 chr6D 55434578 55435147 569 True 654 654 87.348 2442 3017 1 chr6D.!!$R1 575
19 TraesCS1D01G150500 chr3D 177014105 177014761 656 True 693 693 85.714 2442 3104 1 chr3D.!!$R1 662
20 TraesCS1D01G150500 chr2A 271913747 271914331 584 True 686 686 87.858 2442 3031 1 chr2A.!!$R1 589

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
812 838 2.674796 ACGAGAGCTCAACAATACCC 57.325 50.0 17.77 0.0 0.0 3.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2601 2670 1.003718 GAGGACAAGACCAACCCCG 60.004 63.158 0.0 0.0 0.0 5.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
389 397 6.488683 TGGCAACTTTAGTTTAAGCACTATGT 59.511 34.615 5.98 0.00 35.83 2.29
421 429 6.237901 AGTGTAAACATCATGGCAACTTCTA 58.762 36.000 0.00 0.00 37.61 2.10
480 492 5.892348 ACATGGGGTCTAGTTTTGAAGATT 58.108 37.500 0.00 0.00 0.00 2.40
646 659 2.787249 CGATCTGCAAACGCCCAG 59.213 61.111 0.00 0.00 0.00 4.45
647 660 2.753966 CGATCTGCAAACGCCCAGG 61.754 63.158 0.00 0.00 0.00 4.45
730 747 3.300009 GAAAACTCAAGCCGTTGACATG 58.700 45.455 0.00 0.00 37.79 3.21
812 838 2.674796 ACGAGAGCTCAACAATACCC 57.325 50.000 17.77 0.00 0.00 3.69
1140 1198 1.004918 GGAGTTGCTACACTGCCGT 60.005 57.895 0.13 0.00 0.00 5.68
1401 1459 4.899239 GCGGAGGAGGACATGCGG 62.899 72.222 0.00 0.00 41.43 5.69
1744 1802 4.451150 CGGCCTACTTCCGCAGCA 62.451 66.667 0.00 0.00 40.46 4.41
2238 2304 0.108138 CCTTCCCTCGTTCGATGCTT 60.108 55.000 0.00 0.00 0.00 3.91
2264 2332 0.601841 GTGAGGCTCCGTTCCGAAAA 60.602 55.000 12.86 0.00 0.00 2.29
2382 2450 9.847224 TTTAAAACATCTTCCCATATAGGAGTC 57.153 33.333 0.00 0.00 41.22 3.36
2385 2453 8.798975 AAACATCTTCCCATATAGGAGTCTTA 57.201 34.615 0.00 0.00 41.22 2.10
2431 2499 3.826524 TGGTTCATTAGAGCAAACCACA 58.173 40.909 1.83 0.00 44.62 4.17
2432 2500 3.568007 TGGTTCATTAGAGCAAACCACAC 59.432 43.478 1.83 0.00 44.62 3.82
2513 2582 1.468520 GCATAAGAAGGCAACGCAGAA 59.531 47.619 0.00 0.00 46.39 3.02
2600 2669 2.659428 CCCCAGGGCTTCTATGAAAAG 58.341 52.381 0.00 0.00 0.00 2.27
2601 2670 2.027385 CCCAGGGCTTCTATGAAAAGC 58.973 52.381 0.00 0.00 46.66 3.51
2666 2738 1.798813 GACGCTTCTTTTGACCACGAT 59.201 47.619 0.00 0.00 0.00 3.73
2744 2817 5.244402 TGCATGAGACAACAGGAAAATTGAT 59.756 36.000 0.00 0.00 0.00 2.57
2811 2884 1.185618 TCTAACACTGGCGCAGAGGT 61.186 55.000 10.83 4.88 35.18 3.85
3055 3129 5.926542 GGTTTGAGGAGCCTTTAAATGAAAC 59.073 40.000 0.00 0.00 0.00 2.78
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
73 74 9.533253 GCAATAGACATGGCAACTTTTAATAAT 57.467 29.630 0.00 0.00 30.66 1.28
194 200 6.879458 GGCAAGTCTAGTTTCTTAATTCTCCA 59.121 38.462 0.00 0.00 0.00 3.86
389 397 7.334858 TGCCATGATGTTTACACTATAGTTGA 58.665 34.615 1.56 0.00 0.00 3.18
436 447 7.484641 CCATGTTGATATGTTTCGACGAATTTT 59.515 33.333 11.71 1.80 33.42 1.82
437 448 6.966632 CCATGTTGATATGTTTCGACGAATTT 59.033 34.615 11.71 2.15 33.42 1.82
438 449 6.458206 CCCATGTTGATATGTTTCGACGAATT 60.458 38.462 11.71 2.51 33.42 2.17
439 450 5.007626 CCCATGTTGATATGTTTCGACGAAT 59.992 40.000 11.71 0.00 33.42 3.34
575 588 6.450545 CCACGTATGAATAGATGACATCAGT 58.549 40.000 17.57 2.70 0.00 3.41
646 659 1.788067 AAAACTAACGCCCACACGCC 61.788 55.000 0.00 0.00 36.19 5.68
647 660 0.029700 AAAAACTAACGCCCACACGC 59.970 50.000 0.00 0.00 36.19 5.34
730 747 1.835121 GGTTCAGTTTTTGACGTGGC 58.165 50.000 0.00 0.00 34.94 5.01
740 757 2.719354 GCCAACGCGGTTCAGTTT 59.281 55.556 12.47 0.00 36.97 2.66
812 838 4.440103 CGAGTCCGACTAATTAAACGATGG 59.560 45.833 0.00 0.00 38.22 3.51
1036 1094 4.384485 CGACAGCATCGTCATCGT 57.616 55.556 2.43 0.00 46.25 3.73
1140 1198 3.138798 GTCTGGACGAGGCGGCTA 61.139 66.667 13.24 0.00 34.07 3.93
1259 1317 4.694233 AGCAGAGCTGGTGCCGTG 62.694 66.667 12.97 0.00 42.24 4.94
1401 1459 3.974757 CGTATCCCGTCGGCCTCC 61.975 72.222 5.50 0.00 0.00 4.30
1509 1567 4.522689 ATGCACGCGCCGGACATA 62.523 61.111 5.05 0.00 37.32 2.29
1563 1621 1.799181 GCGAGCTCGAAATAGCACTCA 60.799 52.381 38.74 0.00 45.30 3.41
1676 1734 2.584418 CGATCTGGTGCTGCTCGG 60.584 66.667 0.00 0.00 0.00 4.63
2264 2332 5.945191 GGTTCTCTGGTCTAACTACTACAGT 59.055 44.000 0.00 0.00 40.05 3.55
2431 2499 4.808558 ACAACAATCATTTTGCTATGCGT 58.191 34.783 0.00 0.00 0.00 5.24
2432 2500 5.097529 AGACAACAATCATTTTGCTATGCG 58.902 37.500 0.00 0.00 0.00 4.73
2513 2582 9.901172 TCATAGAAATCTGATATGCATTATGCT 57.099 29.630 18.44 6.57 45.31 3.79
2524 2593 8.099537 GGCAAGAATCCTCATAGAAATCTGATA 58.900 37.037 0.00 0.00 0.00 2.15
2600 2669 2.671963 GGACAAGACCAACCCCGC 60.672 66.667 0.00 0.00 0.00 6.13
2601 2670 1.003718 GAGGACAAGACCAACCCCG 60.004 63.158 0.00 0.00 0.00 5.73
2666 2738 2.500098 CCCCATCGTGTTCTTAAGGAGA 59.500 50.000 1.85 0.00 0.00 3.71
2744 2817 3.433709 CATCAAAACATCCGCGCAATAA 58.566 40.909 8.75 0.00 0.00 1.40
2811 2884 5.670792 ATAATAAGGCGATTACATCCCGA 57.329 39.130 0.00 0.00 0.00 5.14


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.