Multiple sequence alignment - TraesCS1D01G150200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G150200 chr1D 100.000 2732 0 0 1 2732 207152462 207155193 0.000000e+00 5046.0
1 TraesCS1D01G150200 chr1D 97.325 2168 47 5 419 2582 163675024 163672864 0.000000e+00 3672.0
2 TraesCS1D01G150200 chr1D 97.021 2115 51 4 473 2582 344156681 344158788 0.000000e+00 3546.0
3 TraesCS1D01G150200 chr1D 97.830 2028 39 2 560 2582 11241108 11239081 0.000000e+00 3496.0
4 TraesCS1D01G150200 chr1D 96.364 275 10 0 13 287 344156176 344156450 1.150000e-123 453.0
5 TraesCS1D01G150200 chr1D 97.748 222 5 0 11 232 163675476 163675255 1.530000e-102 383.0
6 TraesCS1D01G150200 chr1D 98.718 156 2 0 2577 2732 37903579 37903424 7.450000e-71 278.0
7 TraesCS1D01G150200 chr1D 98.718 156 2 0 2577 2732 51930783 51930628 7.450000e-71 278.0
8 TraesCS1D01G150200 chr1D 98.718 156 2 0 2577 2732 155713648 155713803 7.450000e-71 278.0
9 TraesCS1D01G150200 chr1D 98.718 156 2 0 2577 2732 196482055 196481900 7.450000e-71 278.0
10 TraesCS1D01G150200 chr1D 98.718 156 2 0 2577 2732 333229947 333229792 7.450000e-71 278.0
11 TraesCS1D01G150200 chr1D 98.718 156 2 0 2577 2732 479725044 479725199 7.450000e-71 278.0
12 TraesCS1D01G150200 chr1D 81.395 86 11 5 271 351 163675275 163675190 6.310000e-07 65.8
13 TraesCS1D01G150200 chr2D 94.814 2603 90 35 12 2582 345860043 345862632 0.000000e+00 4017.0
14 TraesCS1D01G150200 chr2D 97.432 2103 47 4 487 2582 128303451 128305553 0.000000e+00 3578.0
15 TraesCS1D01G150200 chr2D 90.047 422 26 10 13 431 128302912 128303320 1.440000e-147 532.0
16 TraesCS1D01G150200 chr2D 92.336 274 13 2 13 281 85604762 85605032 1.530000e-102 383.0
17 TraesCS1D01G150200 chr2D 88.450 329 23 13 12 335 120544466 120544148 1.530000e-102 383.0
18 TraesCS1D01G150200 chr2D 100.000 35 0 0 382 416 284552513 284552547 6.310000e-07 65.8
19 TraesCS1D01G150200 chr2D 94.872 39 2 0 378 416 405625498 405625460 8.170000e-06 62.1
20 TraesCS1D01G150200 chr3D 95.997 2348 75 12 243 2582 84017753 84020089 0.000000e+00 3797.0
21 TraesCS1D01G150200 chr3D 88.201 339 27 10 12 345 16901118 16901448 2.550000e-105 392.0
22 TraesCS1D01G150200 chr3D 95.279 233 9 2 2 232 303391450 303391682 4.300000e-98 368.0
23 TraesCS1D01G150200 chr3D 92.574 202 11 4 450 648 541182876 541183076 1.240000e-73 287.0
24 TraesCS1D01G150200 chr6D 97.639 2118 42 5 469 2582 266791629 266789516 0.000000e+00 3627.0
25 TraesCS1D01G150200 chr6D 97.738 221 5 0 12 232 266792011 266791791 5.520000e-102 381.0
26 TraesCS1D01G150200 chr6D 98.718 156 2 0 2577 2732 7688102 7688257 7.450000e-71 278.0
27 TraesCS1D01G150200 chr6D 94.872 39 2 0 378 416 86937417 86937455 8.170000e-06 62.1
28 TraesCS1D01G150200 chr5D 98.170 2022 33 1 562 2579 77002201 77004222 0.000000e+00 3526.0
29 TraesCS1D01G150200 chr5D 90.749 227 16 2 414 640 17468511 17468732 5.720000e-77 298.0
30 TraesCS1D01G150200 chr5D 99.359 156 1 0 2577 2732 17470543 17470698 1.600000e-72 283.0
31 TraesCS1D01G150200 chr4D 98.026 2026 33 2 561 2582 493748188 493746166 0.000000e+00 3513.0
32 TraesCS1D01G150200 chr4D 98.718 156 2 0 2577 2732 317193049 317193204 7.450000e-71 278.0
33 TraesCS1D01G150200 chr7D 91.289 287 15 4 1 281 554145794 554146076 1.530000e-102 383.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G150200 chr1D 207152462 207155193 2731 False 5046.0 5046 100.0000 1 2732 1 chr1D.!!$F2 2731
1 TraesCS1D01G150200 chr1D 11239081 11241108 2027 True 3496.0 3496 97.8300 560 2582 1 chr1D.!!$R1 2022
2 TraesCS1D01G150200 chr1D 344156176 344158788 2612 False 1999.5 3546 96.6925 13 2582 2 chr1D.!!$F4 2569
3 TraesCS1D01G150200 chr1D 163672864 163675476 2612 True 1373.6 3672 92.1560 11 2582 3 chr1D.!!$R6 2571
4 TraesCS1D01G150200 chr2D 345860043 345862632 2589 False 4017.0 4017 94.8140 12 2582 1 chr2D.!!$F3 2570
5 TraesCS1D01G150200 chr2D 128302912 128305553 2641 False 2055.0 3578 93.7395 13 2582 2 chr2D.!!$F4 2569
6 TraesCS1D01G150200 chr3D 84017753 84020089 2336 False 3797.0 3797 95.9970 243 2582 1 chr3D.!!$F2 2339
7 TraesCS1D01G150200 chr6D 266789516 266792011 2495 True 2004.0 3627 97.6885 12 2582 2 chr6D.!!$R1 2570
8 TraesCS1D01G150200 chr5D 77002201 77004222 2021 False 3526.0 3526 98.1700 562 2579 1 chr5D.!!$F1 2017
9 TraesCS1D01G150200 chr5D 17468511 17470698 2187 False 290.5 298 95.0540 414 2732 2 chr5D.!!$F2 2318
10 TraesCS1D01G150200 chr4D 493746166 493748188 2022 True 3513.0 3513 98.0260 561 2582 1 chr4D.!!$R1 2021

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
703 1015 0.034896 GGGTGTTCTTTCTGGCGAGA 59.965 55.0 0.0 0.0 0.0 4.04 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2481 2807 1.117994 TGAACCATGGCAGCAAAACA 58.882 45.0 13.04 0.0 0.0 2.83 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
85 86 3.473113 AGGGGTTTCCTGCATATGTTT 57.527 42.857 4.29 0.00 46.07 2.83
519 826 2.740826 CGCCGTTCATGGAACCGT 60.741 61.111 3.72 0.00 39.14 4.83
626 938 3.454447 TGTCCGGTGATCTTTGATGGTAT 59.546 43.478 0.00 0.00 0.00 2.73
703 1015 0.034896 GGGTGTTCTTTCTGGCGAGA 59.965 55.000 0.00 0.00 0.00 4.04
818 1130 1.407989 GGCTAAGCTTGCTGATGAGGT 60.408 52.381 9.86 0.00 0.00 3.85
923 1235 2.092592 AGTGGCTTGATGATGATGCTCA 60.093 45.455 0.00 0.00 0.00 4.26
1126 1438 6.378280 TGATGACTTCTATGCACAGAGTTCTA 59.622 38.462 0.00 0.00 0.00 2.10
1265 1577 4.344865 GGAGTTTGAGCCCCGGCA 62.345 66.667 8.74 0.00 44.88 5.69
1286 1598 0.937304 GCTCAGTTGTTTGCTCGTGA 59.063 50.000 0.00 0.00 0.00 4.35
1394 1706 0.173708 CTCGCTACTCGGGCTTCTTT 59.826 55.000 0.00 0.00 39.05 2.52
1549 1861 0.738389 CACAAAGCGGAAACACCTGT 59.262 50.000 0.00 0.00 36.31 4.00
1588 1900 1.827969 CCTCAGGGACTTCGTCATCTT 59.172 52.381 0.00 0.00 34.60 2.40
1669 1981 2.041115 GCGGCTTCAGGTTCTTCCC 61.041 63.158 0.00 0.00 36.75 3.97
1729 2041 2.365635 AGCACCCGCCCTCTACAT 60.366 61.111 0.00 0.00 39.83 2.29
1750 2062 1.213296 GTCAGGTACATCCCCATGGT 58.787 55.000 11.73 0.00 36.75 3.55
1762 2074 1.355720 CCCCATGGTTTCTGGACTCTT 59.644 52.381 11.73 0.00 35.70 2.85
1892 2204 0.915364 AGAGGCCATCTTTCCACTCC 59.085 55.000 5.01 0.00 32.99 3.85
1893 2205 0.915364 GAGGCCATCTTTCCACTCCT 59.085 55.000 5.01 0.00 0.00 3.69
1894 2206 1.283321 GAGGCCATCTTTCCACTCCTT 59.717 52.381 5.01 0.00 0.00 3.36
2234 2559 1.305046 TCGAGGTCTTCTGGGGTCC 60.305 63.158 0.00 0.00 0.00 4.46
2252 2577 0.660488 CCGTCTCAGGAGATGTCTCG 59.340 60.000 15.36 8.12 43.76 4.04
2663 3026 2.545596 GCAATGATGATCGCCGCCA 61.546 57.895 0.00 0.00 0.00 5.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 8.948631 TTATAACTCTAACAGAAATCAGGCAG 57.051 34.615 0.00 0.00 0.00 4.85
85 86 8.899771 CCGATATATATACATGTACAGGTGTGA 58.100 37.037 22.69 9.47 0.00 3.58
216 217 1.443872 GAGAGAGAAAACGCGGCGA 60.444 57.895 30.94 0.00 0.00 5.54
276 277 3.184683 GGCAGAAGAGACGCAGCG 61.185 66.667 14.82 14.82 0.00 5.18
510 817 2.431942 GTCGCACGACGGTTCCAT 60.432 61.111 7.51 0.00 43.89 3.41
529 837 0.244178 GAAAAGCCGAGACGAGGAGT 59.756 55.000 0.00 0.00 0.00 3.85
532 840 0.458716 GAGGAAAAGCCGAGACGAGG 60.459 60.000 0.00 0.00 43.43 4.63
818 1130 2.102925 TCATCATAGGCACGATCAGCAA 59.897 45.455 9.11 0.00 0.00 3.91
923 1235 0.036448 AGTGAGAACAGCTGCAGCAT 59.964 50.000 38.24 24.28 45.16 3.79
1265 1577 1.265095 CACGAGCAAACAACTGAGCAT 59.735 47.619 0.00 0.00 0.00 3.79
1286 1598 2.103263 GCCTCCATGAGAGAAATACGGT 59.897 50.000 11.48 0.00 46.50 4.83
1394 1706 2.427320 GTGCAGCAGGTGGAGTGA 59.573 61.111 0.00 0.00 0.00 3.41
1549 1861 2.896854 GGATGATCGCGCCTTGCA 60.897 61.111 0.00 0.00 46.97 4.08
1588 1900 4.087892 GGCTGAAGCTGGCGAGGA 62.088 66.667 1.74 0.00 41.70 3.71
1669 1981 2.830704 GAACCAGCAGTACCCGTCGG 62.831 65.000 3.60 3.60 0.00 4.79
1729 2041 2.022428 ACCATGGGGATGTACCTGACTA 60.022 50.000 18.09 0.00 38.98 2.59
1750 2062 4.696479 AAGAAGCTCAAGAGTCCAGAAA 57.304 40.909 0.00 0.00 0.00 2.52
1762 2074 7.389232 TGAGAAGACATATGAAAAGAAGCTCA 58.611 34.615 10.38 7.94 0.00 4.26
1892 2204 6.373774 AGCAACATCAGGAACAGAATAAGAAG 59.626 38.462 0.00 0.00 0.00 2.85
1893 2205 6.240894 AGCAACATCAGGAACAGAATAAGAA 58.759 36.000 0.00 0.00 0.00 2.52
1894 2206 5.809001 AGCAACATCAGGAACAGAATAAGA 58.191 37.500 0.00 0.00 0.00 2.10
2234 2559 1.374560 ACGAGACATCTCCTGAGACG 58.625 55.000 0.00 1.14 40.75 4.18
2252 2577 2.035576 ACGACAACCCTGACACTCTAAC 59.964 50.000 0.00 0.00 0.00 2.34
2481 2807 1.117994 TGAACCATGGCAGCAAAACA 58.882 45.000 13.04 0.00 0.00 2.83
2663 3026 2.162681 CCAAAAATGAGGCGGAAGAGT 58.837 47.619 0.00 0.00 0.00 3.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.