Multiple sequence alignment - TraesCS1D01G137600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G137600 chr1D 100.000 2619 0 0 1 2619 187808473 187811091 0 4837
1 TraesCS1D01G137600 chr2D 98.398 2622 38 3 1 2619 644817767 644820387 0 4606
2 TraesCS1D01G137600 chr7D 97.634 2620 60 2 1 2619 29571720 29569102 0 4494
3 TraesCS1D01G137600 chr4D 97.408 2623 64 3 1 2619 403008997 403011619 0 4464
4 TraesCS1D01G137600 chr5A 97.332 2624 65 3 1 2619 139476838 139474215 0 4453
5 TraesCS1D01G137600 chr4B 94.877 2635 115 9 1 2619 74348786 74351416 0 4100
6 TraesCS1D01G137600 chr2B 94.656 2283 111 6 348 2619 63131873 63129591 0 3530
7 TraesCS1D01G137600 chr3D 95.191 2038 90 6 585 2619 107214418 107216450 0 3214
8 TraesCS1D01G137600 chr3D 94.781 594 24 5 1 589 107205661 107206252 0 918
9 TraesCS1D01G137600 chr6D 91.989 1810 97 15 1 1781 433250901 433252691 0 2495
10 TraesCS1D01G137600 chr6A 97.145 1366 32 4 1 1360 615073844 615072480 0 2300
11 TraesCS1D01G137600 chr6A 97.670 987 22 1 1633 2619 615072488 615071503 0 1694
12 TraesCS1D01G137600 chr2A 92.203 1616 91 12 184 1781 605004802 605003204 0 2254
13 TraesCS1D01G137600 chr7B 95.227 1257 59 1 1363 2619 400417620 400416365 0 1988
14 TraesCS1D01G137600 chr6B 94.151 530 27 3 1 527 128934559 128934031 0 804


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G137600 chr1D 187808473 187811091 2618 False 4837 4837 100.0000 1 2619 1 chr1D.!!$F1 2618
1 TraesCS1D01G137600 chr2D 644817767 644820387 2620 False 4606 4606 98.3980 1 2619 1 chr2D.!!$F1 2618
2 TraesCS1D01G137600 chr7D 29569102 29571720 2618 True 4494 4494 97.6340 1 2619 1 chr7D.!!$R1 2618
3 TraesCS1D01G137600 chr4D 403008997 403011619 2622 False 4464 4464 97.4080 1 2619 1 chr4D.!!$F1 2618
4 TraesCS1D01G137600 chr5A 139474215 139476838 2623 True 4453 4453 97.3320 1 2619 1 chr5A.!!$R1 2618
5 TraesCS1D01G137600 chr4B 74348786 74351416 2630 False 4100 4100 94.8770 1 2619 1 chr4B.!!$F1 2618
6 TraesCS1D01G137600 chr2B 63129591 63131873 2282 True 3530 3530 94.6560 348 2619 1 chr2B.!!$R1 2271
7 TraesCS1D01G137600 chr3D 107214418 107216450 2032 False 3214 3214 95.1910 585 2619 1 chr3D.!!$F2 2034
8 TraesCS1D01G137600 chr3D 107205661 107206252 591 False 918 918 94.7810 1 589 1 chr3D.!!$F1 588
9 TraesCS1D01G137600 chr6D 433250901 433252691 1790 False 2495 2495 91.9890 1 1781 1 chr6D.!!$F1 1780
10 TraesCS1D01G137600 chr6A 615071503 615073844 2341 True 1997 2300 97.4075 1 2619 2 chr6A.!!$R1 2618
11 TraesCS1D01G137600 chr2A 605003204 605004802 1598 True 2254 2254 92.2030 184 1781 1 chr2A.!!$R1 1597
12 TraesCS1D01G137600 chr7B 400416365 400417620 1255 True 1988 1988 95.2270 1363 2619 1 chr7B.!!$R1 1256
13 TraesCS1D01G137600 chr6B 128934031 128934559 528 True 804 804 94.1510 1 527 1 chr6B.!!$R1 526

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
828 864 0.169672 GCATTGTCGCAAGCTCACAT 59.83 50.0 0.0 0.0 37.18 3.21 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2243 2310 3.067106 CCGCTGAAAAAGTGAGCTAGAA 58.933 45.455 0.0 0.0 38.83 2.1 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
60 65 3.181400 GGGAGATAGGAGGAAGGGAGATT 60.181 52.174 0.00 0.0 0.00 2.40
148 153 7.287696 TGAGCCACTCAAATATGTATGTCTCTA 59.712 37.037 0.00 0.0 37.57 2.43
346 354 6.318900 GGAAAATTTGAATAGACCTCGTCCAT 59.681 38.462 0.00 0.0 32.18 3.41
378 386 2.094906 TCCTCGTACATCAGGTTGAACG 60.095 50.000 0.00 0.0 31.55 3.95
443 454 3.369787 CCACATATCTCACTTGTGCTGGA 60.370 47.826 0.00 0.0 39.48 3.86
467 478 7.606839 GGACCCCTAGAATATGCTAATGTTTAC 59.393 40.741 0.00 0.0 0.00 2.01
517 528 6.126409 TCAGTGGACTTTACATGGTTTCTTT 58.874 36.000 0.00 0.0 0.00 2.52
828 864 0.169672 GCATTGTCGCAAGCTCACAT 59.830 50.000 0.00 0.0 37.18 3.21
1070 1107 7.391833 ACACTTCTTAATTTTGATCAGGGACTC 59.608 37.037 0.00 0.0 34.60 3.36
1186 1228 2.266055 CAGAGGGAGACAACGGCC 59.734 66.667 0.00 0.0 0.00 6.13
1278 1320 0.698238 ATTCTGCAGCAAGGGTGGTA 59.302 50.000 9.47 0.0 33.05 3.25
1466 1512 1.005748 CTTCGTGACTGAGCTGGCA 60.006 57.895 0.00 0.0 0.00 4.92
1572 1618 2.154462 CACCGAAAAGAAGGATGCTGT 58.846 47.619 0.00 0.0 0.00 4.40
1648 1707 4.218200 TGTGCGTGATCCATTCATTCTTTT 59.782 37.500 0.00 0.0 36.54 2.27
1686 1753 6.789268 TCCCCTCAACTCAGATTCATTTTAA 58.211 36.000 0.00 0.0 0.00 1.52
2098 2165 5.627499 TTAGTGTGCAATTCAGATTCACC 57.373 39.130 0.00 0.0 0.00 4.02
2121 2188 6.545298 ACCCAGCATTTTTCTTAAATTTTGCA 59.455 30.769 9.24 0.0 31.63 4.08
2408 2475 0.318120 CATGTTGGGGCTTGGTTGAC 59.682 55.000 0.00 0.0 0.00 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
60 65 6.794534 TCTTCCTCTCTCTACATATATGCCA 58.205 40.000 12.79 0.25 0.00 4.92
148 153 3.061231 TTGCCCGTGCGATGCAAT 61.061 55.556 14.14 0.00 41.47 3.56
313 321 9.088987 AGGTCTATTCAAATTTTCCTAAAGCAA 57.911 29.630 0.00 0.00 0.00 3.91
346 354 3.804786 TGTACGAGGAAATTATCGGCA 57.195 42.857 11.02 7.44 43.12 5.69
378 386 7.199766 TGACCACTCACAACATAAACAAAATC 58.800 34.615 0.00 0.00 0.00 2.17
443 454 8.276453 AGTAAACATTAGCATATTCTAGGGGT 57.724 34.615 0.00 0.00 0.00 4.95
656 691 1.927174 CTTGTGTGTATAGTCAGCCGC 59.073 52.381 0.00 0.00 0.00 6.53
828 864 0.545071 TGAGATGTGTGCCTCCCTCA 60.545 55.000 0.00 0.00 0.00 3.86
1064 1101 3.139029 GACCACAATGTCGAGTCCC 57.861 57.895 0.00 0.00 0.00 4.46
1186 1228 5.794687 TGTTGTGGTTATTCTGAATAGCG 57.205 39.130 15.18 0.00 0.00 4.26
1278 1320 5.105877 TGCTTGCTACAACTATCTTCTACGT 60.106 40.000 0.00 0.00 0.00 3.57
1466 1512 6.212955 CGTTTCCACCACTGACATTTTATTT 58.787 36.000 0.00 0.00 0.00 1.40
1572 1618 0.523072 GAACCCAGTACGTGTCGCTA 59.477 55.000 0.00 0.00 0.00 4.26
1648 1707 5.015178 AGTTGAGGGGAATAAGGATCAAACA 59.985 40.000 0.00 0.00 0.00 2.83
1686 1753 9.537192 CCATCAAAATCATGCATAAGTACAAAT 57.463 29.630 0.00 0.00 0.00 2.32
2098 2165 7.061326 GCATGCAAAATTTAAGAAAAATGCTGG 59.939 33.333 14.21 3.01 35.48 4.85
2121 2188 8.310122 AGTTGACATTAATAATTTCCAGGCAT 57.690 30.769 0.00 0.00 0.00 4.40
2242 2309 3.498397 CCGCTGAAAAAGTGAGCTAGAAA 59.502 43.478 0.00 0.00 38.83 2.52
2243 2310 3.067106 CCGCTGAAAAAGTGAGCTAGAA 58.933 45.455 0.00 0.00 38.83 2.10
2323 2390 5.453567 TTGTGATAGTGGATAGGATCGTG 57.546 43.478 0.00 0.00 0.00 4.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.