Multiple sequence alignment - TraesCS1D01G137300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G137300 chr1D 100.000 2319 0 0 1 2319 185769456 185771774 0 4283
1 TraesCS1D01G137300 chr5A 98.880 2321 24 1 1 2319 300072978 300075298 0 4141
2 TraesCS1D01G137300 chr5A 98.577 2319 31 1 1 2319 16602920 16600604 0 4098
3 TraesCS1D01G137300 chrUn 98.837 2321 25 1 1 2319 189392538 189394858 0 4135
4 TraesCS1D01G137300 chr2A 98.794 2321 26 1 1 2319 618279957 618277637 0 4130
5 TraesCS1D01G137300 chr7D 98.664 2321 29 1 1 2319 626698491 626696171 0 4113
6 TraesCS1D01G137300 chr7D 98.534 2320 33 1 1 2319 203556346 203554027 0 4095
7 TraesCS1D01G137300 chr7B 98.664 2321 29 2 1 2319 743086198 743088518 0 4113
8 TraesCS1D01G137300 chr6A 98.621 2320 30 2 1 2319 289128631 289130949 0 4106
9 TraesCS1D01G137300 chr7A 98.452 2325 30 2 1 2319 4959837 4962161 0 4089


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G137300 chr1D 185769456 185771774 2318 False 4283 4283 100.000 1 2319 1 chr1D.!!$F1 2318
1 TraesCS1D01G137300 chr5A 300072978 300075298 2320 False 4141 4141 98.880 1 2319 1 chr5A.!!$F1 2318
2 TraesCS1D01G137300 chr5A 16600604 16602920 2316 True 4098 4098 98.577 1 2319 1 chr5A.!!$R1 2318
3 TraesCS1D01G137300 chrUn 189392538 189394858 2320 False 4135 4135 98.837 1 2319 1 chrUn.!!$F1 2318
4 TraesCS1D01G137300 chr2A 618277637 618279957 2320 True 4130 4130 98.794 1 2319 1 chr2A.!!$R1 2318
5 TraesCS1D01G137300 chr7D 626696171 626698491 2320 True 4113 4113 98.664 1 2319 1 chr7D.!!$R2 2318
6 TraesCS1D01G137300 chr7D 203554027 203556346 2319 True 4095 4095 98.534 1 2319 1 chr7D.!!$R1 2318
7 TraesCS1D01G137300 chr7B 743086198 743088518 2320 False 4113 4113 98.664 1 2319 1 chr7B.!!$F1 2318
8 TraesCS1D01G137300 chr6A 289128631 289130949 2318 False 4106 4106 98.621 1 2319 1 chr6A.!!$F1 2318
9 TraesCS1D01G137300 chr7A 4959837 4962161 2324 False 4089 4089 98.452 1 2319 1 chr7A.!!$F1 2318

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
888 891 1.749063 CTTCCCCTTTTTACCCATCGC 59.251 52.381 0.0 0.0 0.0 4.58 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2161 2171 2.583143 CTGTTTTCGGGTTCCCTTTCT 58.417 47.619 6.31 0.0 0.0 2.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
34 35 2.940994 TCGACAAGGGGTTTGATTCA 57.059 45.000 0.00 0.00 39.21 2.57
538 541 4.789012 TTACCCGACTCGTAACTTCAAT 57.211 40.909 0.00 0.00 0.00 2.57
888 891 1.749063 CTTCCCCTTTTTACCCATCGC 59.251 52.381 0.00 0.00 0.00 4.58
911 915 4.925646 CACTCGACTCACATTTTGATCTCA 59.074 41.667 0.00 0.00 32.17 3.27
1361 1366 8.789762 GCTAAAATGTTCTTAGTGAAAGGGTTA 58.210 33.333 0.00 0.00 36.30 2.85
1459 1464 2.158310 TCCTCAGTCAAGGGTCTTCTCA 60.158 50.000 0.00 0.00 37.02 3.27
1551 1556 4.321899 GCAAGTGACTCTCTCTCACAAGAT 60.322 45.833 1.67 0.00 40.56 2.40
1602 1612 6.205464 TCCAATTTGATCAGAAGTGAGTTCAC 59.795 38.462 15.09 4.09 46.77 3.18
1662 1672 3.556999 TCTCAGCTAATAGAAGCCGAGT 58.443 45.455 8.49 0.00 44.14 4.18
1668 1678 5.861251 CAGCTAATAGAAGCCGAGTTATCTG 59.139 44.000 0.00 0.00 43.86 2.90
1805 1815 0.107800 GGGAGTTAGGGCTTCGGTTC 60.108 60.000 0.00 0.00 0.00 3.62
2015 2025 4.558095 GCATTGCTGACTGACTGTTTGAAT 60.558 41.667 0.16 0.00 0.00 2.57
2161 2171 4.167319 TCATCGAAATATCCTCATCCCCA 58.833 43.478 0.00 0.00 0.00 4.96
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
34 35 7.308435 CGACCTTATCTTTTTGCTCAAAGAAT 58.692 34.615 12.95 6.65 44.18 2.40
538 541 3.266513 TGGATTGAGATGGATGGTTGTGA 59.733 43.478 0.00 0.00 0.00 3.58
832 835 6.298361 TCTGATGTGAATTCTTCTGGTTTGA 58.702 36.000 7.05 0.00 0.00 2.69
888 891 4.925646 TGAGATCAAAATGTGAGTCGAGTG 59.074 41.667 0.00 0.00 40.43 3.51
911 915 2.076863 GGACTGTGAAAGCAAGCGTAT 58.923 47.619 0.00 0.00 0.00 3.06
982 986 3.318017 ACATATTGAATCTACGCTCGCC 58.682 45.455 0.00 0.00 0.00 5.54
1038 1042 2.681152 AACGAAACGAATGTGGCTTC 57.319 45.000 0.00 0.00 0.00 3.86
1112 1117 3.525609 GGAGGAAGAAGAGGGGATTTCTT 59.474 47.826 0.00 0.00 44.10 2.52
1361 1366 2.105328 GTTTGCCGGTTTTGCGGT 59.895 55.556 1.90 0.00 0.00 5.68
1459 1464 9.469807 TTGTTATGTTTTTGATCTTATTTGCGT 57.530 25.926 0.00 0.00 0.00 5.24
1524 1529 6.286956 TGTGAGAGAGAGTCACTTGCTGTG 62.287 50.000 4.96 4.43 44.02 3.66
1551 1556 7.597288 TGGATGAATCGGTAATCTTTCTCTA 57.403 36.000 0.00 0.00 0.00 2.43
1602 1612 5.607119 AAGGTTTCGCTATACAACAACAG 57.393 39.130 0.00 0.00 0.00 3.16
1668 1678 1.275291 TCGTTCAACCCTGATCTGGAC 59.725 52.381 19.59 8.50 0.00 4.02
2161 2171 2.583143 CTGTTTTCGGGTTCCCTTTCT 58.417 47.619 6.31 0.00 0.00 2.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.