Multiple sequence alignment - TraesCS1D01G137200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G137200 chr1D 100.000 2258 0 0 1 2258 185762555 185764812 0 4170
1 TraesCS1D01G137200 chr4D 97.944 1216 20 2 1045 2258 483697924 483699136 0 2102
2 TraesCS1D01G137200 chr4D 97.284 1215 31 2 1045 2258 135004657 135003444 0 2060
3 TraesCS1D01G137200 chr4D 96.543 1215 41 1 1045 2258 241141681 241140467 0 2010
4 TraesCS1D01G137200 chr4D 97.714 1050 23 1 1 1049 123663925 123662876 0 1805
5 TraesCS1D01G137200 chr1B 96.867 1213 37 1 1047 2258 286168155 286169367 0 2028
6 TraesCS1D01G137200 chr1B 95.806 1216 48 3 1045 2258 286024828 286023614 0 1960
7 TraesCS1D01G137200 chr7A 96.464 1216 41 2 1045 2258 571649001 571650216 0 2006
8 TraesCS1D01G137200 chr5D 96.132 1215 46 1 1045 2258 79866819 79868033 0 1982
9 TraesCS1D01G137200 chr5D 94.152 1214 66 5 1045 2258 197838334 197837126 0 1844
10 TraesCS1D01G137200 chrUn 98.189 1049 19 0 1 1049 237257428 237256380 0 1832
11 TraesCS1D01G137200 chrUn 98.189 1049 19 0 1 1049 399834716 399833668 0 1832
12 TraesCS1D01G137200 chr7D 98.189 1049 19 0 1 1049 579015980 579017028 0 1832
13 TraesCS1D01G137200 chr1A 98.093 1049 20 0 1 1049 238154728 238153680 0 1827
14 TraesCS1D01G137200 chr1A 97.712 1049 24 0 1 1049 238109343 238108295 0 1805
15 TraesCS1D01G137200 chr5A 97.617 1049 25 0 1 1049 16577518 16576470 0 1799
16 TraesCS1D01G137200 chr3A 97.617 1049 25 0 1 1049 191855951 191856999 0 1799
17 TraesCS1D01G137200 chr7B 97.521 1049 26 0 1 1049 716830618 716831666 0 1794
18 TraesCS1D01G137200 chr7B 98.261 920 15 1 1340 2258 743080627 743081546 0 1609
19 TraesCS1D01G137200 chr5B 96.260 909 34 0 1045 1953 87747602 87748510 0 1491


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G137200 chr1D 185762555 185764812 2257 False 4170 4170 100.000 1 2258 1 chr1D.!!$F1 2257
1 TraesCS1D01G137200 chr4D 483697924 483699136 1212 False 2102 2102 97.944 1045 2258 1 chr4D.!!$F1 1213
2 TraesCS1D01G137200 chr4D 135003444 135004657 1213 True 2060 2060 97.284 1045 2258 1 chr4D.!!$R2 1213
3 TraesCS1D01G137200 chr4D 241140467 241141681 1214 True 2010 2010 96.543 1045 2258 1 chr4D.!!$R3 1213
4 TraesCS1D01G137200 chr4D 123662876 123663925 1049 True 1805 1805 97.714 1 1049 1 chr4D.!!$R1 1048
5 TraesCS1D01G137200 chr1B 286168155 286169367 1212 False 2028 2028 96.867 1047 2258 1 chr1B.!!$F1 1211
6 TraesCS1D01G137200 chr1B 286023614 286024828 1214 True 1960 1960 95.806 1045 2258 1 chr1B.!!$R1 1213
7 TraesCS1D01G137200 chr7A 571649001 571650216 1215 False 2006 2006 96.464 1045 2258 1 chr7A.!!$F1 1213
8 TraesCS1D01G137200 chr5D 79866819 79868033 1214 False 1982 1982 96.132 1045 2258 1 chr5D.!!$F1 1213
9 TraesCS1D01G137200 chr5D 197837126 197838334 1208 True 1844 1844 94.152 1045 2258 1 chr5D.!!$R1 1213
10 TraesCS1D01G137200 chrUn 237256380 237257428 1048 True 1832 1832 98.189 1 1049 1 chrUn.!!$R1 1048
11 TraesCS1D01G137200 chrUn 399833668 399834716 1048 True 1832 1832 98.189 1 1049 1 chrUn.!!$R2 1048
12 TraesCS1D01G137200 chr7D 579015980 579017028 1048 False 1832 1832 98.189 1 1049 1 chr7D.!!$F1 1048
13 TraesCS1D01G137200 chr1A 238153680 238154728 1048 True 1827 1827 98.093 1 1049 1 chr1A.!!$R2 1048
14 TraesCS1D01G137200 chr1A 238108295 238109343 1048 True 1805 1805 97.712 1 1049 1 chr1A.!!$R1 1048
15 TraesCS1D01G137200 chr5A 16576470 16577518 1048 True 1799 1799 97.617 1 1049 1 chr5A.!!$R1 1048
16 TraesCS1D01G137200 chr3A 191855951 191856999 1048 False 1799 1799 97.617 1 1049 1 chr3A.!!$F1 1048
17 TraesCS1D01G137200 chr7B 716830618 716831666 1048 False 1794 1794 97.521 1 1049 1 chr7B.!!$F1 1048
18 TraesCS1D01G137200 chr7B 743080627 743081546 919 False 1609 1609 98.261 1340 2258 1 chr7B.!!$F2 918
19 TraesCS1D01G137200 chr5B 87747602 87748510 908 False 1491 1491 96.260 1045 1953 1 chr5B.!!$F1 908

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
117 118 1.441732 GAACGGGCGGGCGAAATTAT 61.442 55.0 0.0 0.0 0.0 1.28 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1559 1561 1.808133 GCTATCGGGAAAGTCTGGCAG 60.808 57.143 8.58 8.58 0.0 4.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
40 41 5.643348 GCTTAAGGCATTGGTTTGCTAAATT 59.357 36.000 4.29 0.00 42.38 1.82
117 118 1.441732 GAACGGGCGGGCGAAATTAT 61.442 55.000 0.00 0.00 0.00 1.28
366 367 2.291605 TGGTAGCTCAGCTGGTTAGAGA 60.292 50.000 10.31 0.00 40.10 3.10
379 380 5.890334 CTGGTTAGAGAAAAACAAGCAACA 58.110 37.500 0.00 0.00 0.00 3.33
432 433 1.803334 TAGCGCATCCGTTTTCTTGT 58.197 45.000 11.47 0.00 36.67 3.16
532 534 3.067106 TCCACATCTGAGCGTCTTTTTC 58.933 45.455 0.00 0.00 0.00 2.29
721 723 3.947834 CCTATCCAGAAAAATTGTCGGCT 59.052 43.478 0.00 0.00 0.00 5.52
818 820 4.788925 TTTGTTATCCCTGATCCGGAAT 57.211 40.909 9.01 0.00 31.75 3.01
872 874 6.655003 TCCTAACAAGATTGATCTGTTTGGAC 59.345 38.462 17.76 0.00 40.30 4.02
1168 1170 1.560505 GCCAGGTGTGAAATCCCATT 58.439 50.000 0.00 0.00 0.00 3.16
1399 1401 6.106648 ACTTACTTAACTTACCGCTTTCCT 57.893 37.500 0.00 0.00 0.00 3.36
1559 1561 2.057922 TCCTCAGCCAGATATTTCCCC 58.942 52.381 0.00 0.00 0.00 4.81
1655 1657 1.880027 CCGTCTTGCCTTTGCTACTTT 59.120 47.619 0.00 0.00 38.71 2.66
1682 1684 1.743252 CCTTTGACCGAGCAGCTCC 60.743 63.158 17.16 3.49 0.00 4.70
1858 1860 0.830866 ACCGTCCTCTTCCCTTCGTT 60.831 55.000 0.00 0.00 0.00 3.85
1863 1865 4.142093 CCGTCCTCTTCCCTTCGTTAATAA 60.142 45.833 0.00 0.00 0.00 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
40 41 7.716560 CCCATGATACAATCTTCTTGTATGTCA 59.283 37.037 13.67 8.85 43.39 3.58
117 118 5.305386 TCAATCTGAGGTTCTTTCTCTCACA 59.695 40.000 0.00 0.00 34.33 3.58
268 269 0.793250 GAGCTTGCTCAAGAACCGAC 59.207 55.000 16.71 0.00 40.79 4.79
721 723 2.419021 GGGATCGGAACCACATTCGTAA 60.419 50.000 6.63 0.00 38.31 3.18
800 802 4.065789 GTGAATTCCGGATCAGGGATAAC 58.934 47.826 4.15 7.49 32.58 1.89
818 820 3.133901 GCCCAAGGAAAAGAAAAGGTGAA 59.866 43.478 0.00 0.00 0.00 3.18
872 874 4.265206 GGCCATCATGGACCAAGG 57.735 61.111 8.30 0.00 40.64 3.61
1025 1027 4.636206 GCCGTTTTTCTTCTCTACCATGAT 59.364 41.667 0.00 0.00 0.00 2.45
1168 1170 5.419542 CAAATCCTTGACTCCTCGAATACA 58.580 41.667 0.00 0.00 34.14 2.29
1559 1561 1.808133 GCTATCGGGAAAGTCTGGCAG 60.808 57.143 8.58 8.58 0.00 4.85
1655 1657 2.418746 GCTCGGTCAAAGGCATTCTCTA 60.419 50.000 0.00 0.00 0.00 2.43
1682 1684 9.294030 GTTTGATTGCTAATAAAATGAGTGGAG 57.706 33.333 0.00 0.00 0.00 3.86
1858 1860 7.775053 AAGCATGGTTGGAGTTCTTTTATTA 57.225 32.000 9.83 0.00 0.00 0.98
1863 1865 4.218312 AGAAAGCATGGTTGGAGTTCTTT 58.782 39.130 11.56 0.00 0.00 2.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.