Multiple sequence alignment - TraesCS1D01G137100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G137100 chr1D 100.000 2357 0 0 1 2357 185762154 185764510 0 4353
1 TraesCS1D01G137100 chr7D 98.345 1450 24 0 1 1450 579015579 579017028 0 2545
2 TraesCS1D01G137100 chrUn 98.207 1450 26 0 1 1450 237257829 237256380 0 2534
3 TraesCS1D01G137100 chr1A 98.069 1450 28 0 1 1450 238155129 238153680 0 2523
4 TraesCS1D01G137100 chr1A 98.000 1450 29 0 1 1450 238109744 238108295 0 2518
5 TraesCS1D01G137100 chr1A 97.726 1451 32 1 1 1450 278506347 278507797 0 2495
6 TraesCS1D01G137100 chr5A 97.862 1450 31 0 1 1450 16577919 16576470 0 2507
7 TraesCS1D01G137100 chr7B 97.724 1450 33 0 1 1450 716830217 716831666 0 2495
8 TraesCS1D01G137100 chr3A 97.724 1450 33 0 1 1450 191855550 191856999 0 2495
9 TraesCS1D01G137100 chr6B 97.724 1450 31 2 1 1450 394496644 394498091 0 2494
10 TraesCS1D01G137100 chr4D 98.348 908 15 0 1446 2353 483697924 483698831 0 1594
11 TraesCS1D01G137100 chr4D 97.371 913 22 2 1446 2357 135004657 135003746 0 1552
12 TraesCS1D01G137100 chr4D 96.495 913 31 1 1446 2357 241141681 241140769 0 1507
13 TraesCS1D01G137100 chr7A 97.039 912 27 0 1446 2357 571649001 571649912 0 1535
14 TraesCS1D01G137100 chr1B 96.707 911 29 1 1448 2357 286168155 286169065 0 1515
15 TraesCS1D01G137100 chr1B 95.619 913 39 1 1446 2357 286024828 286023916 0 1463
16 TraesCS1D01G137100 chr5B 96.260 909 34 0 1446 2354 87747602 87748510 0 1491
17 TraesCS1D01G137100 chr5D 96.057 913 35 1 1446 2357 79866819 79867731 0 1485
18 TraesCS1D01G137100 chr5D 94.189 912 49 4 1446 2357 197838334 197837427 0 1387


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G137100 chr1D 185762154 185764510 2356 False 4353 4353 100.000 1 2357 1 chr1D.!!$F1 2356
1 TraesCS1D01G137100 chr7D 579015579 579017028 1449 False 2545 2545 98.345 1 1450 1 chr7D.!!$F1 1449
2 TraesCS1D01G137100 chrUn 237256380 237257829 1449 True 2534 2534 98.207 1 1450 1 chrUn.!!$R1 1449
3 TraesCS1D01G137100 chr1A 238153680 238155129 1449 True 2523 2523 98.069 1 1450 1 chr1A.!!$R2 1449
4 TraesCS1D01G137100 chr1A 238108295 238109744 1449 True 2518 2518 98.000 1 1450 1 chr1A.!!$R1 1449
5 TraesCS1D01G137100 chr1A 278506347 278507797 1450 False 2495 2495 97.726 1 1450 1 chr1A.!!$F1 1449
6 TraesCS1D01G137100 chr5A 16576470 16577919 1449 True 2507 2507 97.862 1 1450 1 chr5A.!!$R1 1449
7 TraesCS1D01G137100 chr7B 716830217 716831666 1449 False 2495 2495 97.724 1 1450 1 chr7B.!!$F1 1449
8 TraesCS1D01G137100 chr3A 191855550 191856999 1449 False 2495 2495 97.724 1 1450 1 chr3A.!!$F1 1449
9 TraesCS1D01G137100 chr6B 394496644 394498091 1447 False 2494 2494 97.724 1 1450 1 chr6B.!!$F1 1449
10 TraesCS1D01G137100 chr4D 483697924 483698831 907 False 1594 1594 98.348 1446 2353 1 chr4D.!!$F1 907
11 TraesCS1D01G137100 chr4D 135003746 135004657 911 True 1552 1552 97.371 1446 2357 1 chr4D.!!$R1 911
12 TraesCS1D01G137100 chr4D 241140769 241141681 912 True 1507 1507 96.495 1446 2357 1 chr4D.!!$R2 911
13 TraesCS1D01G137100 chr7A 571649001 571649912 911 False 1535 1535 97.039 1446 2357 1 chr7A.!!$F1 911
14 TraesCS1D01G137100 chr1B 286168155 286169065 910 False 1515 1515 96.707 1448 2357 1 chr1B.!!$F1 909
15 TraesCS1D01G137100 chr1B 286023916 286024828 912 True 1463 1463 95.619 1446 2357 1 chr1B.!!$R1 911
16 TraesCS1D01G137100 chr5B 87747602 87748510 908 False 1491 1491 96.260 1446 2354 1 chr5B.!!$F1 908
17 TraesCS1D01G137100 chr5D 79866819 79867731 912 False 1485 1485 96.057 1446 2357 1 chr5D.!!$F1 911
18 TraesCS1D01G137100 chr5D 197837427 197838334 907 True 1387 1387 94.189 1446 2357 1 chr5D.!!$R1 911

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
91 92 0.539669 ACCGGGCTTTTTCCCTTCTG 60.54 55.0 6.32 0.0 44.3 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1960 1962 1.808133 GCTATCGGGAAAGTCTGGCAG 60.808 57.143 8.58 8.58 0.0 4.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
19 20 2.119671 CGTGGATCGATCATGACGAA 57.880 50.000 26.86 5.77 42.80 3.85
72 73 2.122769 TCACGGTCCTGTTCCCCA 60.123 61.111 0.00 0.00 0.00 4.96
91 92 0.539669 ACCGGGCTTTTTCCCTTCTG 60.540 55.000 6.32 0.00 44.30 3.02
267 268 1.153539 TTGGTTTGGATGGGGTCTCA 58.846 50.000 0.00 0.00 0.00 3.27
441 442 5.643348 GCTTAAGGCATTGGTTTGCTAAATT 59.357 36.000 4.29 0.00 42.38 1.82
518 519 1.441732 GAACGGGCGGGCGAAATTAT 61.442 55.000 0.00 0.00 0.00 1.28
767 768 2.291605 TGGTAGCTCAGCTGGTTAGAGA 60.292 50.000 10.31 0.00 40.10 3.10
780 781 5.890334 CTGGTTAGAGAAAAACAAGCAACA 58.110 37.500 0.00 0.00 0.00 3.33
833 834 1.803334 TAGCGCATCCGTTTTCTTGT 58.197 45.000 11.47 0.00 36.67 3.16
933 934 3.067106 TCCACATCTGAGCGTCTTTTTC 58.933 45.455 0.00 0.00 0.00 2.29
1122 1124 3.947834 CCTATCCAGAAAAATTGTCGGCT 59.052 43.478 0.00 0.00 0.00 5.52
1219 1221 4.788925 TTTGTTATCCCTGATCCGGAAT 57.211 40.909 9.01 0.00 31.75 3.01
1273 1275 6.655003 TCCTAACAAGATTGATCTGTTTGGAC 59.345 38.462 17.76 0.00 40.30 4.02
1569 1571 1.560505 GCCAGGTGTGAAATCCCATT 58.439 50.000 0.00 0.00 0.00 3.16
1800 1802 6.106648 ACTTACTTAACTTACCGCTTTCCT 57.893 37.500 0.00 0.00 0.00 3.36
1960 1962 2.057922 TCCTCAGCCAGATATTTCCCC 58.942 52.381 0.00 0.00 0.00 4.81
2056 2058 1.880027 CCGTCTTGCCTTTGCTACTTT 59.120 47.619 0.00 0.00 38.71 2.66
2083 2085 1.743252 CCTTTGACCGAGCAGCTCC 60.743 63.158 17.16 3.49 0.00 4.70
2259 2261 0.830866 ACCGTCCTCTTCCCTTCGTT 60.831 55.000 0.00 0.00 0.00 3.85
2264 2266 4.142093 CCGTCCTCTTCCCTTCGTTAATAA 60.142 45.833 0.00 0.00 0.00 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
19 20 3.703001 ACATGACGGAGAAGTCCATTT 57.297 42.857 0.00 0.00 44.18 2.32
91 92 6.827586 ATGAATATCTCCTTCGTCTAGTCC 57.172 41.667 0.00 0.00 0.00 3.85
267 268 1.613630 ATCTCCCCAGCGTCCAAGT 60.614 57.895 0.00 0.00 0.00 3.16
441 442 7.716560 CCCATGATACAATCTTCTTGTATGTCA 59.283 37.037 13.67 8.85 43.39 3.58
518 519 5.305386 TCAATCTGAGGTTCTTTCTCTCACA 59.695 40.000 0.00 0.00 34.33 3.58
669 670 0.793250 GAGCTTGCTCAAGAACCGAC 59.207 55.000 16.71 0.00 40.79 4.79
1122 1124 2.419021 GGGATCGGAACCACATTCGTAA 60.419 50.000 6.63 0.00 38.31 3.18
1201 1203 4.065789 GTGAATTCCGGATCAGGGATAAC 58.934 47.826 4.15 7.49 32.58 1.89
1219 1221 3.133901 GCCCAAGGAAAAGAAAAGGTGAA 59.866 43.478 0.00 0.00 0.00 3.18
1273 1275 4.265206 GGCCATCATGGACCAAGG 57.735 61.111 8.30 0.00 40.64 3.61
1426 1428 4.636206 GCCGTTTTTCTTCTCTACCATGAT 59.364 41.667 0.00 0.00 0.00 2.45
1569 1571 5.419542 CAAATCCTTGACTCCTCGAATACA 58.580 41.667 0.00 0.00 34.14 2.29
1960 1962 1.808133 GCTATCGGGAAAGTCTGGCAG 60.808 57.143 8.58 8.58 0.00 4.85
2056 2058 2.418746 GCTCGGTCAAAGGCATTCTCTA 60.419 50.000 0.00 0.00 0.00 2.43
2083 2085 9.294030 GTTTGATTGCTAATAAAATGAGTGGAG 57.706 33.333 0.00 0.00 0.00 3.86
2259 2261 7.775053 AAGCATGGTTGGAGTTCTTTTATTA 57.225 32.000 9.83 0.00 0.00 0.98
2264 2266 4.218312 AGAAAGCATGGTTGGAGTTCTTT 58.782 39.130 11.56 0.00 0.00 2.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.