Multiple sequence alignment - TraesCS1D01G136600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G136600 chr1D 100.000 2614 0 0 1 2614 182580159 182582772 0.000000e+00 4828
1 TraesCS1D01G136600 chr1D 97.889 2037 39 4 580 2614 71287175 71289209 0.000000e+00 3520
2 TraesCS1D01G136600 chr1D 99.314 583 4 0 1 583 16992042 16992624 0.000000e+00 1055
3 TraesCS1D01G136600 chr1D 99.142 583 5 0 1 583 365293780 365294362 0.000000e+00 1050
4 TraesCS1D01G136600 chr2D 98.525 2034 26 4 583 2614 639485012 639482981 0.000000e+00 3587
5 TraesCS1D01G136600 chr2D 97.790 2036 29 6 583 2614 345251459 345253482 0.000000e+00 3496
6 TraesCS1D01G136600 chr2D 80.000 745 140 8 877 1615 37276739 37275998 2.290000e-150 542
7 TraesCS1D01G136600 chr5D 97.708 2051 41 6 567 2614 42206466 42208513 0.000000e+00 3522
8 TraesCS1D01G136600 chr5D 99.142 583 5 0 1 583 4756727 4757309 0.000000e+00 1050
9 TraesCS1D01G136600 chr5D 99.142 583 5 0 1 583 477445144 477445726 0.000000e+00 1050
10 TraesCS1D01G136600 chr7D 96.118 2035 71 8 583 2614 127375811 127377840 0.000000e+00 3314
11 TraesCS1D01G136600 chr7D 97.993 1794 21 4 582 2374 58131752 58129973 0.000000e+00 3099
12 TraesCS1D01G136600 chr7D 99.142 583 5 0 1 583 313748151 313747569 0.000000e+00 1050
13 TraesCS1D01G136600 chr7D 98.824 85 0 1 2530 2614 58129996 58129913 1.620000e-32 150
14 TraesCS1D01G136600 chr1A 89.438 1922 146 31 584 2497 546519079 546520951 0.000000e+00 2372
15 TraesCS1D01G136600 chr2A 88.534 1378 115 28 1128 2497 32113979 32115321 0.000000e+00 1629
16 TraesCS1D01G136600 chr2A 91.935 434 31 2 583 1013 32113534 32113966 2.880000e-169 604
17 TraesCS1D01G136600 chr6D 99.142 583 5 0 1 583 69225421 69226003 0.000000e+00 1050
18 TraesCS1D01G136600 chr6D 99.142 583 5 0 1 583 428608476 428607894 0.000000e+00 1050
19 TraesCS1D01G136600 chr6D 99.142 583 5 0 1 583 450317317 450317899 0.000000e+00 1050
20 TraesCS1D01G136600 chr4D 99.142 583 5 0 1 583 144219955 144219373 0.000000e+00 1050


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G136600 chr1D 182580159 182582772 2613 False 4828.0 4828 100.0000 1 2614 1 chr1D.!!$F3 2613
1 TraesCS1D01G136600 chr1D 71287175 71289209 2034 False 3520.0 3520 97.8890 580 2614 1 chr1D.!!$F2 2034
2 TraesCS1D01G136600 chr1D 16992042 16992624 582 False 1055.0 1055 99.3140 1 583 1 chr1D.!!$F1 582
3 TraesCS1D01G136600 chr1D 365293780 365294362 582 False 1050.0 1050 99.1420 1 583 1 chr1D.!!$F4 582
4 TraesCS1D01G136600 chr2D 639482981 639485012 2031 True 3587.0 3587 98.5250 583 2614 1 chr2D.!!$R2 2031
5 TraesCS1D01G136600 chr2D 345251459 345253482 2023 False 3496.0 3496 97.7900 583 2614 1 chr2D.!!$F1 2031
6 TraesCS1D01G136600 chr2D 37275998 37276739 741 True 542.0 542 80.0000 877 1615 1 chr2D.!!$R1 738
7 TraesCS1D01G136600 chr5D 42206466 42208513 2047 False 3522.0 3522 97.7080 567 2614 1 chr5D.!!$F2 2047
8 TraesCS1D01G136600 chr5D 4756727 4757309 582 False 1050.0 1050 99.1420 1 583 1 chr5D.!!$F1 582
9 TraesCS1D01G136600 chr5D 477445144 477445726 582 False 1050.0 1050 99.1420 1 583 1 chr5D.!!$F3 582
10 TraesCS1D01G136600 chr7D 127375811 127377840 2029 False 3314.0 3314 96.1180 583 2614 1 chr7D.!!$F1 2031
11 TraesCS1D01G136600 chr7D 58129913 58131752 1839 True 1624.5 3099 98.4085 582 2614 2 chr7D.!!$R2 2032
12 TraesCS1D01G136600 chr7D 313747569 313748151 582 True 1050.0 1050 99.1420 1 583 1 chr7D.!!$R1 582
13 TraesCS1D01G136600 chr1A 546519079 546520951 1872 False 2372.0 2372 89.4380 584 2497 1 chr1A.!!$F1 1913
14 TraesCS1D01G136600 chr2A 32113534 32115321 1787 False 1116.5 1629 90.2345 583 2497 2 chr2A.!!$F1 1914
15 TraesCS1D01G136600 chr6D 69225421 69226003 582 False 1050.0 1050 99.1420 1 583 1 chr6D.!!$F1 582
16 TraesCS1D01G136600 chr6D 428607894 428608476 582 True 1050.0 1050 99.1420 1 583 1 chr6D.!!$R1 582
17 TraesCS1D01G136600 chr6D 450317317 450317899 582 False 1050.0 1050 99.1420 1 583 1 chr6D.!!$F2 582
18 TraesCS1D01G136600 chr4D 144219373 144219955 582 True 1050.0 1050 99.1420 1 583 1 chr4D.!!$R1 582

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
101 102 1.10051 ACCGACGATCAAATCTCGGA 58.899 50.0 22.77 0.0 44.97 4.55 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1690 1702 7.472543 GCTTCGACCAACTACAAAATCATAAT 58.527 34.615 0.0 0.0 0.0 1.28 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
58 59 4.677250 CGAGTAAAGAGACTTGCCGGTAAT 60.677 45.833 5.11 0.0 0.00 1.89
101 102 1.100510 ACCGACGATCAAATCTCGGA 58.899 50.000 22.77 0.0 44.97 4.55
730 735 3.454587 AAGAGACGTTGGTGGCGCA 62.455 57.895 10.83 0.0 0.00 6.09
1089 1098 1.246056 TGACCTACGTTGCTAGGCGT 61.246 55.000 1.87 0.0 44.02 5.68
1276 1288 1.379044 GGTGGCAGCAAGGCTATGT 60.379 57.895 12.58 0.0 44.55 2.29
1339 1351 0.739813 CAAATCGGTCCGGGTCAGAC 60.740 60.000 12.29 0.0 0.00 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
58 59 8.325421 GTATCTCGATACCTAGTTCAATCTCA 57.675 38.462 5.90 0.0 38.12 3.27
101 102 4.339872 TTGTCACCGGTATGTTACTTGT 57.660 40.909 6.87 0.0 0.00 3.16
730 735 0.745468 GAAATCCTCGTCTACCGCCT 59.255 55.000 0.00 0.0 36.19 5.52
735 740 2.094854 ACACCGTGAAATCCTCGTCTAC 60.095 50.000 5.28 0.0 0.00 2.59
1690 1702 7.472543 GCTTCGACCAACTACAAAATCATAAT 58.527 34.615 0.00 0.0 0.00 1.28


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.