Multiple sequence alignment - TraesCS1D01G135000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G135000 chr1D 100.000 2255 0 0 1 2255 176207808 176205554 0.000000e+00 4165.0
1 TraesCS1D01G135000 chr6D 98.537 2255 33 0 1 2255 389250442 389248188 0.000000e+00 3982.0
2 TraesCS1D01G135000 chr6D 98.537 2255 33 0 1 2255 389255237 389252983 0.000000e+00 3982.0
3 TraesCS1D01G135000 chr3A 98.492 2255 33 1 1 2255 66007064 66009317 0.000000e+00 3975.0
4 TraesCS1D01G135000 chr3A 97.916 2255 47 0 1 2255 672899453 672901707 0.000000e+00 3904.0
5 TraesCS1D01G135000 chr3A 98.212 1622 29 0 1 1622 593312756 593311135 0.000000e+00 2835.0
6 TraesCS1D01G135000 chr3A 97.590 332 8 0 1009 1340 23881391 23881060 9.040000e-159 569.0
7 TraesCS1D01G135000 chr3A 92.283 311 16 6 1314 1617 507105707 507106016 3.440000e-118 435.0
8 TraesCS1D01G135000 chr3A 97.183 213 6 0 1 213 650016443 650016655 5.920000e-96 361.0
9 TraesCS1D01G135000 chr3A 97.409 193 5 0 1 193 593077348 593077540 1.670000e-86 329.0
10 TraesCS1D01G135000 chr3A 96.757 185 5 1 499 682 706922140 706921956 7.820000e-80 307.0
11 TraesCS1D01G135000 chr3A 98.802 167 2 0 1298 1464 56249691 56249857 4.710000e-77 298.0
12 TraesCS1D01G135000 chr3A 95.930 172 6 1 953 1124 492292543 492292373 6.130000e-71 278.0
13 TraesCS1D01G135000 chr3A 97.619 126 3 0 1070 1195 697273803 697273678 1.360000e-52 217.0
14 TraesCS1D01G135000 chr3A 99.020 102 1 0 1527 1628 513340783 513340682 1.380000e-42 183.0
15 TraesCS1D01G135000 chr3A 95.495 111 5 0 1471 1581 684307099 684307209 6.400000e-41 178.0
16 TraesCS1D01G135000 chr3A 98.889 90 1 0 2135 2224 123644421 123644332 6.450000e-36 161.0
17 TraesCS1D01G135000 chr3A 97.849 93 1 1 809 901 420166200 420166291 2.320000e-35 159.0
18 TraesCS1D01G135000 chr3A 98.851 87 1 0 706 792 69941413 69941499 3.000000e-34 156.0
19 TraesCS1D01G135000 chr3A 94.792 96 5 0 2087 2182 27006259 27006164 1.400000e-32 150.0
20 TraesCS1D01G135000 chr3A 79.878 164 33 0 85 248 633099491 633099328 1.090000e-23 121.0
21 TraesCS1D01G135000 chr3A 92.537 67 3 2 1709 1774 374359568 374359503 6.630000e-16 95.3
22 TraesCS1D01G135000 chr3A 100.000 45 0 0 979 1023 334687860 334687904 1.440000e-12 84.2
23 TraesCS1D01G135000 chr3A 97.917 48 1 0 632 679 338701369 338701416 1.440000e-12 84.2
24 TraesCS1D01G135000 chr3B 97.916 2255 46 1 1 2255 201537588 201535335 0.000000e+00 3903.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G135000 chr1D 176205554 176207808 2254 True 4165 4165 100.000 1 2255 1 chr1D.!!$R1 2254
1 TraesCS1D01G135000 chr6D 389248188 389255237 7049 True 3982 3982 98.537 1 2255 2 chr6D.!!$R1 2254
2 TraesCS1D01G135000 chr3A 66007064 66009317 2253 False 3975 3975 98.492 1 2255 1 chr3A.!!$F2 2254
3 TraesCS1D01G135000 chr3A 672899453 672901707 2254 False 3904 3904 97.916 1 2255 1 chr3A.!!$F10 2254
4 TraesCS1D01G135000 chr3A 593311135 593312756 1621 True 2835 2835 98.212 1 1622 1 chr3A.!!$R7 1621
5 TraesCS1D01G135000 chr3B 201535335 201537588 2253 True 3903 3903 97.916 1 2255 1 chr3B.!!$R1 2254

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
111 112 0.036732 ATTGCTCCGTCAGGCTTTCA 59.963 50.0 0.0 0.0 37.47 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1739 6535 0.179094 CCCGCGGTAGCAATAGAACA 60.179 55.0 26.12 0.0 45.49 3.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
62 63 6.102897 TCTTCTCCGAGAAAAGAAGTTGAT 57.897 37.500 11.94 0.0 45.64 2.57
111 112 0.036732 ATTGCTCCGTCAGGCTTTCA 59.963 50.000 0.00 0.0 37.47 2.69
213 214 1.683385 CGGACCAGCTACTGATCATCA 59.317 52.381 0.00 0.0 32.44 3.07
218 219 3.521126 ACCAGCTACTGATCATCACCTTT 59.479 43.478 0.00 0.0 32.44 3.11
393 394 0.923358 ACTGGAAACACCACTTCCCA 59.077 50.000 0.00 0.0 44.64 4.37
421 422 3.628005 CATGTGTTAAGCATGCCGG 57.372 52.632 15.66 0.0 37.50 6.13
463 464 4.039004 AGGATCGAACTCTCCATGAGATTG 59.961 45.833 5.61 0.0 45.39 2.67
647 648 1.116308 TATCCATTCCCGTTCGCTCA 58.884 50.000 0.00 0.0 0.00 4.26
704 705 6.069088 TCACATTGGGTTTAGGGATAATCAGT 60.069 38.462 0.00 0.0 0.00 3.41
968 5764 6.688385 CGCACATGGTTTCATAAAATCTGTAG 59.312 38.462 0.00 0.0 31.33 2.74
1591 6387 0.324614 TGGTGCCGACAGTTCATCAT 59.675 50.000 0.00 0.0 0.00 2.45
1719 6515 8.902040 AGATAATCGAAATTGAAAAGAACTGC 57.098 30.769 0.00 0.0 0.00 4.40
1739 6535 5.014228 ACTGCCTTTTCTGTATACTTTCCCT 59.986 40.000 4.17 0.0 0.00 4.20
1771 6567 0.532862 CCGCGGGTCTTATGCAATCT 60.533 55.000 20.10 0.0 0.00 2.40
2006 6802 7.694093 AGATTCATACAGAGGAAAAGGTTCTT 58.306 34.615 0.00 0.0 33.92 2.52
2044 6840 5.632902 GCTGTACCTAGAGGATAGGGATAGG 60.633 52.000 10.79 0.0 37.28 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
16 17 7.335627 AGAAACAATGACGGTATATGAGGAAA 58.664 34.615 0.00 0.00 0.00 3.13
24 25 5.125900 TCGGAGAAGAAACAATGACGGTATA 59.874 40.000 0.00 0.00 0.00 1.47
62 63 1.279025 GGTGGAAGGCCTATGGGTCA 61.279 60.000 5.16 0.00 40.27 4.02
213 214 5.249852 TGGTGAGGTAATAGCTTACAAAGGT 59.750 40.000 14.71 0.00 39.23 3.50
218 219 6.406624 GCTAGTTGGTGAGGTAATAGCTTACA 60.407 42.308 14.71 2.97 39.23 2.41
393 394 3.501828 TGCTTAACACATGCAAGTCGAAT 59.498 39.130 0.00 0.00 34.59 3.34
463 464 9.495572 AAGGAAGCTATAAGTAATGCAACTATC 57.504 33.333 0.00 0.00 0.00 2.08
647 648 0.912487 TTGACTTACTCCCCCGCCAT 60.912 55.000 0.00 0.00 0.00 4.40
704 705 2.231478 GGTGGAAGTCATCAGTTCGAGA 59.769 50.000 0.00 0.00 33.22 4.04
815 816 1.349357 AGGAAGAGTGGCCTTGAGTTC 59.651 52.381 3.32 0.43 0.00 3.01
1273 6069 0.263765 TGGGAGGGCTACCGTTATCT 59.736 55.000 0.00 0.00 43.47 1.98
1402 6198 6.697395 TCCGAATGAATCAGTCTTTCTACAA 58.303 36.000 9.07 0.00 37.95 2.41
1591 6387 3.495100 GGCTCTGTGAGTTCTTTCTTCCA 60.495 47.826 0.00 0.00 31.39 3.53
1719 6515 7.168905 AGAACAGGGAAAGTATACAGAAAAGG 58.831 38.462 5.50 0.00 0.00 3.11
1739 6535 0.179094 CCCGCGGTAGCAATAGAACA 60.179 55.000 26.12 0.00 45.49 3.18
2006 6802 4.006989 AGGTACAGCGTTTGCATCAATAA 58.993 39.130 0.00 0.00 46.23 1.40
2044 6840 4.705023 TCATTTCGATTTTTCCCTCTTCCC 59.295 41.667 0.00 0.00 0.00 3.97
2096 6892 4.138290 CTGGGCTCTTCTATCTTCGACTA 58.862 47.826 0.00 0.00 0.00 2.59


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.