Multiple sequence alignment - TraesCS1D01G134900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G134900 chr1D 100.000 2177 0 0 1 2177 176207494 176205318 0.000 4021.0
1 TraesCS1D01G134900 chr6D 98.833 2142 25 0 1 2142 389254923 389252782 0.000 3818.0
2 TraesCS1D01G134900 chr3A 98.739 2142 26 1 1 2142 66007378 66009518 0.000 3805.0
3 TraesCS1D01G134900 chr3A 98.086 2142 41 0 1 2142 672899767 672901908 0.000 3729.0
4 TraesCS1D01G134900 chr5D 98.693 2142 27 1 1 2142 503238780 503236640 0.000 3799.0
5 TraesCS1D01G134900 chr5D 98.780 2132 25 1 11 2142 503243019 503240889 0.000 3792.0
6 TraesCS1D01G134900 chrUn 98.367 2143 31 2 1 2142 216508364 216510503 0.000 3760.0
7 TraesCS1D01G134900 chr3B 98.179 2142 38 1 1 2142 201537274 201535134 0.000 3738.0
8 TraesCS1D01G134900 chr2A 97.806 2142 47 0 1 2142 335845066 335842925 0.000 3696.0
9 TraesCS1D01G134900 chr2B 97.619 2142 51 0 1 2142 474918684 474916543 0.000 3674.0
10 TraesCS1D01G134900 chr2B 92.105 38 3 0 2140 2177 488272341 488272378 0.001 54.7


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G134900 chr1D 176205318 176207494 2176 True 4021.0 4021 100.0000 1 2177 1 chr1D.!!$R1 2176
1 TraesCS1D01G134900 chr6D 389252782 389254923 2141 True 3818.0 3818 98.8330 1 2142 1 chr6D.!!$R1 2141
2 TraesCS1D01G134900 chr3A 66007378 66009518 2140 False 3805.0 3805 98.7390 1 2142 1 chr3A.!!$F1 2141
3 TraesCS1D01G134900 chr3A 672899767 672901908 2141 False 3729.0 3729 98.0860 1 2142 1 chr3A.!!$F2 2141
4 TraesCS1D01G134900 chr5D 503236640 503243019 6379 True 3795.5 3799 98.7365 1 2142 2 chr5D.!!$R1 2141
5 TraesCS1D01G134900 chrUn 216508364 216510503 2139 False 3760.0 3760 98.3670 1 2142 1 chrUn.!!$F1 2141
6 TraesCS1D01G134900 chr3B 201535134 201537274 2140 True 3738.0 3738 98.1790 1 2142 1 chr3B.!!$R1 2141
7 TraesCS1D01G134900 chr2A 335842925 335845066 2141 True 3696.0 3696 97.8060 1 2142 1 chr2A.!!$R1 2141
8 TraesCS1D01G134900 chr2B 474916543 474918684 2141 True 3674.0 3674 97.6190 1 2142 1 chr2B.!!$R1 2141

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
79 4319 0.923358 ACTGGAAACACCACTTCCCA 59.077 50.0 0.0 0.0 44.64 4.37 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1425 5666 0.179094 CCCGCGGTAGCAATAGAACA 60.179 55.0 26.12 0.0 45.49 3.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
79 4319 0.923358 ACTGGAAACACCACTTCCCA 59.077 50.000 0.00 0.0 44.64 4.37
107 4347 3.628005 CATGTGTTAAGCATGCCGG 57.372 52.632 15.66 0.0 37.50 6.13
149 4389 4.039004 AGGATCGAACTCTCCATGAGATTG 59.961 45.833 5.61 0.0 45.39 2.67
333 4573 1.116308 TATCCATTCCCGTTCGCTCA 58.884 50.000 0.00 0.0 0.00 4.26
390 4630 6.069088 TCACATTGGGTTTAGGGATAATCAGT 60.069 38.462 0.00 0.0 0.00 3.41
654 4894 6.688385 CGCACATGGTTTCATAAAATCTGTAG 59.312 38.462 0.00 0.0 31.33 2.74
1277 5518 0.324614 TGGTGCCGACAGTTCATCAT 59.675 50.000 0.00 0.0 0.00 2.45
1405 5646 8.902040 AGATAATCGAAATTGAAAAGAACTGC 57.098 30.769 0.00 0.0 0.00 4.40
1425 5666 5.014228 ACTGCCTTTTCTGTATACTTTCCCT 59.986 40.000 4.17 0.0 0.00 4.20
1457 5698 0.532862 CCGCGGGTCTTATGCAATCT 60.533 55.000 20.10 0.0 0.00 2.40
1692 5933 7.694093 AGATTCATACAGAGGAAAAGGTTCTT 58.306 34.615 0.00 0.0 33.92 2.52
1730 5971 5.632902 GCTGTACCTAGAGGATAGGGATAGG 60.633 52.000 10.79 0.0 37.28 2.57
2129 6372 6.070995 AGGTGAAAATCTCATGTACGGTTCTA 60.071 38.462 0.00 0.0 36.14 2.10
2142 6385 5.481473 TGTACGGTTCTATAAAGGGACAGTT 59.519 40.000 0.00 0.0 0.00 3.16
2143 6386 4.828829 ACGGTTCTATAAAGGGACAGTTG 58.171 43.478 0.00 0.0 0.00 3.16
2144 6387 3.621715 CGGTTCTATAAAGGGACAGTTGC 59.378 47.826 0.00 0.0 0.00 4.17
2145 6388 4.623171 CGGTTCTATAAAGGGACAGTTGCT 60.623 45.833 0.00 0.0 0.00 3.91
2146 6389 5.394883 CGGTTCTATAAAGGGACAGTTGCTA 60.395 44.000 0.00 0.0 0.00 3.49
2147 6390 6.049790 GGTTCTATAAAGGGACAGTTGCTAG 58.950 44.000 0.00 0.0 0.00 3.42
2148 6391 6.127140 GGTTCTATAAAGGGACAGTTGCTAGA 60.127 42.308 0.00 0.0 0.00 2.43
2149 6392 7.328737 GTTCTATAAAGGGACAGTTGCTAGAA 58.671 38.462 0.00 0.0 0.00 2.10
2150 6393 6.875076 TCTATAAAGGGACAGTTGCTAGAAC 58.125 40.000 0.00 0.0 0.00 3.01
2151 6394 3.857157 AAAGGGACAGTTGCTAGAACA 57.143 42.857 0.00 0.0 0.00 3.18
2152 6395 4.373156 AAAGGGACAGTTGCTAGAACAT 57.627 40.909 0.00 0.0 0.00 2.71
2153 6396 5.499004 AAAGGGACAGTTGCTAGAACATA 57.501 39.130 0.00 0.0 0.00 2.29
2154 6397 5.700402 AAGGGACAGTTGCTAGAACATAT 57.300 39.130 0.00 0.0 0.00 1.78
2155 6398 5.700402 AGGGACAGTTGCTAGAACATATT 57.300 39.130 0.00 0.0 0.00 1.28
2156 6399 6.808321 AGGGACAGTTGCTAGAACATATTA 57.192 37.500 0.00 0.0 0.00 0.98
2157 6400 7.380423 AGGGACAGTTGCTAGAACATATTAT 57.620 36.000 0.00 0.0 0.00 1.28
2158 6401 8.492415 AGGGACAGTTGCTAGAACATATTATA 57.508 34.615 0.00 0.0 0.00 0.98
2159 6402 9.105844 AGGGACAGTTGCTAGAACATATTATAT 57.894 33.333 0.00 0.0 0.00 0.86
2160 6403 9.726438 GGGACAGTTGCTAGAACATATTATATT 57.274 33.333 0.00 0.0 0.00 1.28
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
79 4319 3.501828 TGCTTAACACATGCAAGTCGAAT 59.498 39.130 0.00 0.00 34.59 3.34
149 4389 9.495572 AAGGAAGCTATAAGTAATGCAACTATC 57.504 33.333 0.00 0.00 0.00 2.08
333 4573 0.912487 TTGACTTACTCCCCCGCCAT 60.912 55.000 0.00 0.00 0.00 4.40
390 4630 2.231478 GGTGGAAGTCATCAGTTCGAGA 59.769 50.000 0.00 0.00 33.22 4.04
501 4741 1.349357 AGGAAGAGTGGCCTTGAGTTC 59.651 52.381 3.32 0.43 0.00 3.01
959 5200 0.263765 TGGGAGGGCTACCGTTATCT 59.736 55.000 0.00 0.00 43.47 1.98
1088 5329 6.697395 TCCGAATGAATCAGTCTTTCTACAA 58.303 36.000 9.07 0.00 37.95 2.41
1277 5518 3.495100 GGCTCTGTGAGTTCTTTCTTCCA 60.495 47.826 0.00 0.00 31.39 3.53
1405 5646 7.168905 AGAACAGGGAAAGTATACAGAAAAGG 58.831 38.462 5.50 0.00 0.00 3.11
1425 5666 0.179094 CCCGCGGTAGCAATAGAACA 60.179 55.000 26.12 0.00 45.49 3.18
1692 5933 4.006989 AGGTACAGCGTTTGCATCAATAA 58.993 39.130 0.00 0.00 46.23 1.40
1730 5971 4.705023 TCATTTCGATTTTTCCCTCTTCCC 59.295 41.667 0.00 0.00 0.00 3.97
1782 6025 4.138290 CTGGGCTCTTCTATCTTCGACTA 58.862 47.826 0.00 0.00 0.00 2.59
2129 6372 5.499004 TGTTCTAGCAACTGTCCCTTTAT 57.501 39.130 6.61 0.00 0.00 1.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.