Multiple sequence alignment - TraesCS1D01G133400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G133400 chr1D 100.000 3163 0 0 1 3163 162216383 162219545 0.000000e+00 5842
1 TraesCS1D01G133400 chr1D 99.557 3163 14 0 1 3163 162648927 162652089 0.000000e+00 5764
2 TraesCS1D01G133400 chr1D 93.742 783 47 2 2381 3163 162228448 162229228 0.000000e+00 1173
3 TraesCS1D01G133400 chr1D 93.614 783 47 3 2381 3163 162660552 162661331 0.000000e+00 1166
4 TraesCS1D01G133400 chr1A 94.817 2836 131 12 3 2833 232616174 232618998 0.000000e+00 4409
5 TraesCS1D01G133400 chr1B 92.216 2839 201 18 3 2831 243092828 243095656 0.000000e+00 4000
6 TraesCS1D01G133400 chr4D 89.941 338 32 2 2827 3163 321564581 321564917 4.850000e-118 435
7 TraesCS1D01G133400 chr4D 89.349 338 34 2 2827 3163 321511069 321511405 1.050000e-114 424
8 TraesCS1D01G133400 chr3D 90.994 322 29 0 2842 3163 98280776 98280455 4.850000e-118 435
9 TraesCS1D01G133400 chr2D 90.769 325 26 4 2842 3163 347831996 347832319 6.270000e-117 431
10 TraesCS1D01G133400 chr2D 89.118 340 33 4 2827 3163 347908127 347908465 1.360000e-113 420
11 TraesCS1D01G133400 chr2D 88.750 240 19 6 2539 2774 378094229 378093994 1.440000e-73 287
12 TraesCS1D01G133400 chr7D 89.349 338 35 1 2827 3163 144789409 144789746 1.050000e-114 424
13 TraesCS1D01G133400 chr5B 88.382 241 25 3 2539 2776 355610181 355609941 1.440000e-73 287
14 TraesCS1D01G133400 chr5B 88.017 242 23 6 2540 2776 317297182 317297422 6.680000e-72 281
15 TraesCS1D01G133400 chr2B 87.552 241 26 4 2540 2776 750016995 750016755 3.110000e-70 276


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G133400 chr1D 162216383 162219545 3162 False 5842 5842 100.000 1 3163 1 chr1D.!!$F1 3162
1 TraesCS1D01G133400 chr1D 162648927 162652089 3162 False 5764 5764 99.557 1 3163 1 chr1D.!!$F3 3162
2 TraesCS1D01G133400 chr1D 162228448 162229228 780 False 1173 1173 93.742 2381 3163 1 chr1D.!!$F2 782
3 TraesCS1D01G133400 chr1D 162660552 162661331 779 False 1166 1166 93.614 2381 3163 1 chr1D.!!$F4 782
4 TraesCS1D01G133400 chr1A 232616174 232618998 2824 False 4409 4409 94.817 3 2833 1 chr1A.!!$F1 2830
5 TraesCS1D01G133400 chr1B 243092828 243095656 2828 False 4000 4000 92.216 3 2831 1 chr1B.!!$F1 2828

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1041 1047 5.1251 AGAAACACATTGATGCGACATTT 57.875 34.783 0.0 0.0 0.0 2.32 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2864 2875 2.150014 GAACCAGCAAGGGGCCCTTA 62.15 60.0 36.56 0.0 42.67 2.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1041 1047 5.125100 AGAAACACATTGATGCGACATTT 57.875 34.783 0.00 0.00 0.00 2.32
1516 1522 6.789457 ACTTGATGATGAGTCCATATTCCCTA 59.211 38.462 0.00 0.00 32.09 3.53
2505 2515 6.519679 AAACGGGAGTAAAAGAAGTGTTTT 57.480 33.333 0.00 0.00 46.69 2.43
2848 2859 6.015434 GGTCCAAAGTTGTCATTAGAAACCAT 60.015 38.462 0.00 0.00 0.00 3.55
2864 2875 1.061346 ACCATGGCCACCTATAGGACT 60.061 52.381 26.01 0.18 38.94 3.85
2968 2979 2.890311 CAGGCAGTTTTACCCATGTTCA 59.110 45.455 0.00 0.00 0.00 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1041 1047 6.095860 CAGCATCTCTCAAATTACCATTTCCA 59.904 38.462 0.00 0.00 29.41 3.53
2848 2859 2.427297 CCCTTAGTCCTATAGGTGGCCA 60.427 54.545 18.51 0.00 36.34 5.36
2864 2875 2.150014 GAACCAGCAAGGGGCCCTTA 62.150 60.000 36.56 0.00 42.67 2.69
2968 2979 2.386064 TTTACAACTCACGGCGGCCT 62.386 55.000 18.34 0.89 0.00 5.19


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.