Multiple sequence alignment - TraesCS1D01G132400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G132400 chr1D 100.000 2620 0 0 1 2620 156776733 156779352 0.000000e+00 4839.0
1 TraesCS1D01G132400 chr4A 97.980 1980 33 2 1 1974 41895264 41897242 0.000000e+00 3428.0
2 TraesCS1D01G132400 chr4A 92.034 1180 61 7 1 1170 725870612 725869456 0.000000e+00 1628.0
3 TraesCS1D01G132400 chr4A 91.020 1069 49 14 1553 2620 725869206 725868184 0.000000e+00 1399.0
4 TraesCS1D01G132400 chr4A 95.000 260 13 0 1246 1505 725869454 725869195 2.430000e-110 409.0
5 TraesCS1D01G132400 chr4A 84.615 91 13 1 2531 2620 381208330 381208240 3.590000e-14 89.8
6 TraesCS1D01G132400 chr1A 98.117 1965 29 3 1 1959 452026617 452024655 0.000000e+00 3417.0
7 TraesCS1D01G132400 chr1A 93.994 1382 53 9 1246 2620 548228465 548227107 0.000000e+00 2065.0
8 TraesCS1D01G132400 chr1A 94.643 1176 51 4 5 1170 548229640 548228467 0.000000e+00 1812.0
9 TraesCS1D01G132400 chr3A 97.507 2006 33 4 624 2620 662139618 662141615 0.000000e+00 3411.0
10 TraesCS1D01G132400 chr3A 97.774 629 12 1 1 629 662124526 662125152 0.000000e+00 1083.0
11 TraesCS1D01G132400 chr6A 96.795 1997 33 8 646 2620 99978139 99976152 0.000000e+00 3304.0
12 TraesCS1D01G132400 chr6A 96.860 605 14 3 1 602 100058478 100057876 0.000000e+00 1007.0
13 TraesCS1D01G132400 chr5A 97.864 1873 28 2 754 2620 299774058 299772192 0.000000e+00 3227.0
14 TraesCS1D01G132400 chr5A 98.691 764 10 0 1 764 299775011 299774248 0.000000e+00 1356.0
15 TraesCS1D01G132400 chr2B 92.302 1377 58 18 1246 2620 493242792 493244122 0.000000e+00 1912.0
16 TraesCS1D01G132400 chr2B 94.153 1180 58 3 1 1170 493241612 493242790 0.000000e+00 1786.0
17 TraesCS1D01G132400 chr4B 89.144 1437 98 23 1 1397 570343835 570345253 0.000000e+00 1736.0
18 TraesCS1D01G132400 chr3D 86.458 288 36 2 1423 1709 350130046 350130331 1.960000e-81 313.0
19 TraesCS1D01G132400 chr5B 86.149 296 32 7 1423 1716 468630265 468629977 7.040000e-81 311.0
20 TraesCS1D01G132400 chr7D 84.848 297 37 5 1423 1713 606446030 606446324 2.550000e-75 292.0
21 TraesCS1D01G132400 chrUn 87.037 108 12 2 2334 2441 31522499 31522394 1.270000e-23 121.0
22 TraesCS1D01G132400 chr3B 86.813 91 11 1 2531 2620 732854748 732854838 1.660000e-17 100.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G132400 chr1D 156776733 156779352 2619 False 4839.000000 4839 100.000000 1 2620 1 chr1D.!!$F1 2619
1 TraesCS1D01G132400 chr4A 41895264 41897242 1978 False 3428.000000 3428 97.980000 1 1974 1 chr4A.!!$F1 1973
2 TraesCS1D01G132400 chr4A 725868184 725870612 2428 True 1145.333333 1628 92.684667 1 2620 3 chr4A.!!$R2 2619
3 TraesCS1D01G132400 chr1A 452024655 452026617 1962 True 3417.000000 3417 98.117000 1 1959 1 chr1A.!!$R1 1958
4 TraesCS1D01G132400 chr1A 548227107 548229640 2533 True 1938.500000 2065 94.318500 5 2620 2 chr1A.!!$R2 2615
5 TraesCS1D01G132400 chr3A 662139618 662141615 1997 False 3411.000000 3411 97.507000 624 2620 1 chr3A.!!$F2 1996
6 TraesCS1D01G132400 chr3A 662124526 662125152 626 False 1083.000000 1083 97.774000 1 629 1 chr3A.!!$F1 628
7 TraesCS1D01G132400 chr6A 99976152 99978139 1987 True 3304.000000 3304 96.795000 646 2620 1 chr6A.!!$R1 1974
8 TraesCS1D01G132400 chr6A 100057876 100058478 602 True 1007.000000 1007 96.860000 1 602 1 chr6A.!!$R2 601
9 TraesCS1D01G132400 chr5A 299772192 299775011 2819 True 2291.500000 3227 98.277500 1 2620 2 chr5A.!!$R1 2619
10 TraesCS1D01G132400 chr2B 493241612 493244122 2510 False 1849.000000 1912 93.227500 1 2620 2 chr2B.!!$F1 2619
11 TraesCS1D01G132400 chr4B 570343835 570345253 1418 False 1736.000000 1736 89.144000 1 1397 1 chr4B.!!$F1 1396

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
786 1024 2.025887 AGGGATTCGAGGCAAATTGAGT 60.026 45.455 0.0 0.0 0.0 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2211 2479 2.972713 AGACTACACCAGCCTTGAAAGA 59.027 45.455 0.0 0.0 0.0 2.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
475 506 7.708051 TCTGCTCACTCATTATTACTCTGTAC 58.292 38.462 0.00 0.00 0.00 2.90
786 1024 2.025887 AGGGATTCGAGGCAAATTGAGT 60.026 45.455 0.00 0.00 0.00 3.41
787 1025 2.755103 GGGATTCGAGGCAAATTGAGTT 59.245 45.455 0.00 0.00 0.00 3.01
825 1063 3.587061 TGGTGGATTAAGGAAAGAGCTGA 59.413 43.478 0.00 0.00 0.00 4.26
1456 1700 5.425196 TTGGTAGTGGTTAAGTATGGGAC 57.575 43.478 0.00 0.00 0.00 4.46
1845 2106 4.559153 GCACTGATGCCTAAAATGTGTTT 58.441 39.130 0.00 0.00 46.97 2.83
1992 2254 9.231297 CTATTTTCTTTCTTAACCATCAGACCA 57.769 33.333 0.00 0.00 0.00 4.02
2127 2395 4.515191 GTGACCTGTGACAGAAAAGCAATA 59.485 41.667 15.33 0.00 32.44 1.90
2129 2397 5.769662 TGACCTGTGACAGAAAAGCAATATT 59.230 36.000 15.33 0.00 32.44 1.28
2180 2448 7.865530 TGCCTTTTCTATATATAGTGTCCCA 57.134 36.000 17.44 8.09 0.00 4.37
2181 2449 7.907389 TGCCTTTTCTATATATAGTGTCCCAG 58.093 38.462 17.44 7.87 0.00 4.45
2182 2450 7.512746 TGCCTTTTCTATATATAGTGTCCCAGT 59.487 37.037 17.44 0.00 0.00 4.00
2183 2451 8.035984 GCCTTTTCTATATATAGTGTCCCAGTC 58.964 40.741 17.44 0.36 0.00 3.51
2184 2452 8.532819 CCTTTTCTATATATAGTGTCCCAGTCC 58.467 40.741 17.44 0.00 0.00 3.85
2185 2453 8.431910 TTTTCTATATATAGTGTCCCAGTCCC 57.568 38.462 17.44 0.00 0.00 4.46
2211 2479 4.675063 AGGTTAACTGTTGGGATGGAAT 57.325 40.909 5.42 0.00 0.00 3.01
2226 2494 2.517959 TGGAATCTTTCAAGGCTGGTG 58.482 47.619 0.00 0.00 0.00 4.17
2588 2856 1.568504 GGGTACTGGTGGAGATGTGA 58.431 55.000 0.00 0.00 0.00 3.58
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
494 527 7.059602 CGTCGAACATGCTACAATATAGTACAG 59.940 40.741 0.00 0.00 0.00 2.74
604 642 5.940470 AGGCTCAATAGTTGGTAAGAAACAG 59.060 40.000 0.00 0.00 0.00 3.16
786 1024 1.267574 CCACCTGCTCCAGCTCCTAA 61.268 60.000 0.00 0.00 42.66 2.69
787 1025 1.687146 CCACCTGCTCCAGCTCCTA 60.687 63.158 0.00 0.00 42.66 2.94
825 1063 3.430651 GCAGCTCTAATCTGTCTCTGCTT 60.431 47.826 0.00 0.00 41.37 3.91
1456 1700 2.754946 AGAAAAATGGCAGGTGCATG 57.245 45.000 4.01 0.00 44.36 4.06
2030 2292 5.348164 TGCTTTGCTTTAAAAGGTCTCAAC 58.652 37.500 0.00 0.00 37.58 3.18
2127 2395 6.151817 GGATCAGGCAAACAGAAGTTCTAAAT 59.848 38.462 4.74 0.00 36.84 1.40
2129 2397 5.003804 GGATCAGGCAAACAGAAGTTCTAA 58.996 41.667 4.74 0.00 36.84 2.10
2180 2448 4.225267 CCAACAGTTAACCTAGATGGGACT 59.775 45.833 0.88 0.00 41.11 3.85
2181 2449 4.514401 CCAACAGTTAACCTAGATGGGAC 58.486 47.826 0.88 0.00 41.11 4.46
2182 2450 4.837093 CCAACAGTTAACCTAGATGGGA 57.163 45.455 0.88 0.00 41.11 4.37
2183 2451 3.521937 TCCCAACAGTTAACCTAGATGGG 59.478 47.826 22.33 22.33 46.13 4.00
2184 2452 4.837093 TCCCAACAGTTAACCTAGATGG 57.163 45.455 0.88 7.22 42.93 3.51
2185 2453 5.104527 TCCATCCCAACAGTTAACCTAGATG 60.105 44.000 0.88 6.79 0.00 2.90
2211 2479 2.972713 AGACTACACCAGCCTTGAAAGA 59.027 45.455 0.00 0.00 0.00 2.52
2226 2494 6.740110 ACATTGATAAGATCGACCAGACTAC 58.260 40.000 0.00 0.00 0.00 2.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.