Multiple sequence alignment - TraesCS1D01G130500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G130500 chr1D 100.000 1800 0 0 612 2411 144238516 144236717 0.000000e+00 3325.0
1 TraesCS1D01G130500 chr1D 100.000 511 0 0 1 511 144239127 144238617 0.000000e+00 944.0
2 TraesCS1D01G130500 chrUn 99.058 1805 10 3 612 2411 93416533 93418335 0.000000e+00 3232.0
3 TraesCS1D01G130500 chrUn 98.932 1404 9 5 1010 2411 327660468 327661867 0.000000e+00 2505.0
4 TraesCS1D01G130500 chrUn 99.791 479 1 0 33 511 216509377 216509855 0.000000e+00 880.0
5 TraesCS1D01G130500 chrUn 99.374 479 2 1 33 511 424750415 424750892 0.000000e+00 867.0
6 TraesCS1D01G130500 chr5D 99.003 1805 10 4 612 2411 560880282 560878481 0.000000e+00 3227.0
7 TraesCS1D01G130500 chr5D 99.791 479 1 0 33 511 503237769 503237291 0.000000e+00 880.0
8 TraesCS1D01G130500 chr5D 99.791 479 1 0 33 511 503242018 503241540 0.000000e+00 880.0
9 TraesCS1D01G130500 chr5D 99.582 479 2 0 33 511 503232237 503231759 0.000000e+00 874.0
10 TraesCS1D01G130500 chr5D 100.000 34 0 0 1 34 531563308 531563341 2.000000e-06 63.9
11 TraesCS1D01G130500 chr2D 98.837 1805 12 6 612 2411 272798421 272800221 0.000000e+00 3208.0
12 TraesCS1D01G130500 chr3B 98.448 1804 19 7 612 2411 201522487 201520689 0.000000e+00 3168.0
13 TraesCS1D01G130500 chr3B 99.374 479 3 0 33 511 201536262 201535784 0.000000e+00 869.0
14 TraesCS1D01G130500 chr3B 82.963 270 32 5 612 876 92143283 92143543 5.180000e-57 231.0
15 TraesCS1D01G130500 chr3B 82.963 270 32 5 612 876 92262215 92262475 5.180000e-57 231.0
16 TraesCS1D01G130500 chr3B 86.441 118 14 1 817 932 826653366 826653483 7.000000e-26 128.0
17 TraesCS1D01G130500 chr4A 98.048 1793 25 8 620 2411 722779092 722780875 0.000000e+00 3109.0
18 TraesCS1D01G130500 chr4A 90.215 419 24 3 612 1022 114912598 114912189 4.560000e-147 531.0
19 TraesCS1D01G130500 chr4A 89.032 155 14 2 1010 1162 114896237 114896084 3.160000e-44 189.0
20 TraesCS1D01G130500 chr6A 97.833 1800 27 9 612 2411 271185252 271183465 0.000000e+00 3097.0
21 TraesCS1D01G130500 chr6A 100.000 36 0 0 1 36 232681011 232681046 1.550000e-07 67.6
22 TraesCS1D01G130500 chr6A 100.000 34 0 0 1 34 237765798 237765831 2.000000e-06 63.9
23 TraesCS1D01G130500 chr1A 96.556 1800 46 8 612 2411 168442817 168444600 0.000000e+00 2966.0
24 TraesCS1D01G130500 chr1A 100.000 35 0 0 2 36 144080427 144080461 5.560000e-07 65.8
25 TraesCS1D01G130500 chr1A 97.297 37 1 0 1 37 79950074 79950038 2.000000e-06 63.9
26 TraesCS1D01G130500 chr3A 97.139 1363 28 6 1051 2411 692573172 692571819 0.000000e+00 2290.0
27 TraesCS1D01G130500 chr3A 96.369 358 12 1 637 993 471793340 471792983 2.670000e-164 588.0
28 TraesCS1D01G130500 chr6D 99.791 479 1 0 33 511 389249116 389248638 0.000000e+00 880.0
29 TraesCS1D01G130500 chr6D 99.791 479 1 0 33 511 389253911 389253433 0.000000e+00 880.0
30 TraesCS1D01G130500 chr6D 97.297 37 1 0 1 37 322892425 322892389 2.000000e-06 63.9
31 TraesCS1D01G130500 chr6D 97.297 37 1 0 1 37 361146236 361146200 2.000000e-06 63.9
32 TraesCS1D01G130500 chr7B 99.582 479 2 0 33 511 663102682 663103160 0.000000e+00 874.0
33 TraesCS1D01G130500 chr7A 95.402 522 22 1 612 1131 352186319 352186840 0.000000e+00 830.0
34 TraesCS1D01G130500 chr7A 100.000 36 0 0 1 36 397247195 397247230 1.550000e-07 67.6
35 TraesCS1D01G130500 chr2A 98.347 121 2 0 832 952 187060400 187060280 1.880000e-51 213.0
36 TraesCS1D01G130500 chr7D 100.000 36 0 0 1 36 300294777 300294812 1.550000e-07 67.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G130500 chr1D 144236717 144239127 2410 True 2134.5 3325 100.000 1 2411 2 chr1D.!!$R1 2410
1 TraesCS1D01G130500 chrUn 93416533 93418335 1802 False 3232.0 3232 99.058 612 2411 1 chrUn.!!$F1 1799
2 TraesCS1D01G130500 chrUn 327660468 327661867 1399 False 2505.0 2505 98.932 1010 2411 1 chrUn.!!$F3 1401
3 TraesCS1D01G130500 chr5D 560878481 560880282 1801 True 3227.0 3227 99.003 612 2411 1 chr5D.!!$R2 1799
4 TraesCS1D01G130500 chr5D 503237291 503242018 4727 True 880.0 880 99.791 33 511 2 chr5D.!!$R3 478
5 TraesCS1D01G130500 chr2D 272798421 272800221 1800 False 3208.0 3208 98.837 612 2411 1 chr2D.!!$F1 1799
6 TraesCS1D01G130500 chr3B 201520689 201522487 1798 True 3168.0 3168 98.448 612 2411 1 chr3B.!!$R1 1799
7 TraesCS1D01G130500 chr4A 722779092 722780875 1783 False 3109.0 3109 98.048 620 2411 1 chr4A.!!$F1 1791
8 TraesCS1D01G130500 chr6A 271183465 271185252 1787 True 3097.0 3097 97.833 612 2411 1 chr6A.!!$R1 1799
9 TraesCS1D01G130500 chr1A 168442817 168444600 1783 False 2966.0 2966 96.556 612 2411 1 chr1A.!!$F2 1799
10 TraesCS1D01G130500 chr3A 692571819 692573172 1353 True 2290.0 2290 97.139 1051 2411 1 chr3A.!!$R2 1360
11 TraesCS1D01G130500 chr7A 352186319 352186840 521 False 830.0 830 95.402 612 1131 1 chr7A.!!$F1 519

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
26 27 1.002069 ACCTCAATCCCTTGATGCCA 58.998 50.000 0.0 0.0 40.52 4.92 F
27 28 1.358787 ACCTCAATCCCTTGATGCCAA 59.641 47.619 0.0 0.0 40.52 4.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1256 2866 5.495640 TGGTATAAATTCGTAAACCGGGTT 58.504 37.500 10.96 10.96 37.11 4.11 R
2241 5142 6.429385 CCAATTTTTGGTATAGCTTTTGCCAA 59.571 34.615 12.77 12.77 45.81 4.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
20 21 3.091633 ACAATGGACCTCAATCCCTTG 57.908 47.619 7.90 7.9 45.14 3.61
21 22 2.649312 ACAATGGACCTCAATCCCTTGA 59.351 45.455 14.36 0.0 43.41 3.02
22 23 3.270433 ACAATGGACCTCAATCCCTTGAT 59.730 43.478 14.36 0.2 43.41 2.57
23 24 3.589951 ATGGACCTCAATCCCTTGATG 57.410 47.619 0.00 0.0 40.52 3.07
24 25 1.064463 TGGACCTCAATCCCTTGATGC 60.064 52.381 0.00 0.0 40.52 3.91
25 26 1.685148 GACCTCAATCCCTTGATGCC 58.315 55.000 0.00 0.0 40.52 4.40
26 27 1.002069 ACCTCAATCCCTTGATGCCA 58.998 50.000 0.00 0.0 40.52 4.92
27 28 1.358787 ACCTCAATCCCTTGATGCCAA 59.641 47.619 0.00 0.0 40.52 4.52
29 30 2.622452 CCTCAATCCCTTGATGCCAAGT 60.622 50.000 0.00 0.0 46.37 3.16
30 31 3.094572 CTCAATCCCTTGATGCCAAGTT 58.905 45.455 0.00 0.0 46.37 2.66
31 32 3.509442 TCAATCCCTTGATGCCAAGTTT 58.491 40.909 0.00 0.0 46.37 2.66
484 485 3.589988 GGTCTTATGCAATCGATCGGAT 58.410 45.455 16.41 0.0 36.78 4.18
1256 2866 4.076394 ACCTTTTTAAAGCGTATCAGCCA 58.924 39.130 0.00 0.0 38.01 4.75
1263 2873 2.582436 CGTATCAGCCAACCCGGT 59.418 61.111 0.00 0.0 36.97 5.28
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2 3 3.907221 CATCAAGGGATTGAGGTCCATT 58.093 45.455 0.00 0.00 42.56 3.16
3 4 2.423947 GCATCAAGGGATTGAGGTCCAT 60.424 50.000 4.79 0.00 40.17 3.41
4 5 1.064463 GCATCAAGGGATTGAGGTCCA 60.064 52.381 4.79 0.00 40.17 4.02
5 6 1.685148 GCATCAAGGGATTGAGGTCC 58.315 55.000 4.79 0.00 35.40 4.46
6 7 1.064463 TGGCATCAAGGGATTGAGGTC 60.064 52.381 0.68 0.68 37.79 3.85
7 8 1.002069 TGGCATCAAGGGATTGAGGT 58.998 50.000 4.79 0.00 35.40 3.85
8 9 2.029623 CTTGGCATCAAGGGATTGAGG 58.970 52.381 0.00 0.00 44.89 3.86
18 19 8.250332 GGATTTCTATTACAAACTTGGCATCAA 58.750 33.333 0.00 0.00 0.00 2.57
19 20 7.395772 TGGATTTCTATTACAAACTTGGCATCA 59.604 33.333 0.00 0.00 0.00 3.07
20 21 7.771183 TGGATTTCTATTACAAACTTGGCATC 58.229 34.615 0.00 0.00 0.00 3.91
21 22 7.716799 TGGATTTCTATTACAAACTTGGCAT 57.283 32.000 0.00 0.00 0.00 4.40
22 23 7.178274 ACATGGATTTCTATTACAAACTTGGCA 59.822 33.333 0.00 0.00 0.00 4.92
23 24 7.547227 ACATGGATTTCTATTACAAACTTGGC 58.453 34.615 0.00 0.00 0.00 4.52
24 25 8.190784 GGACATGGATTTCTATTACAAACTTGG 58.809 37.037 0.00 0.00 0.00 3.61
25 26 8.960591 AGGACATGGATTTCTATTACAAACTTG 58.039 33.333 0.00 0.00 0.00 3.16
27 28 9.614792 GTAGGACATGGATTTCTATTACAAACT 57.385 33.333 0.00 0.00 0.00 2.66
28 29 8.837389 GGTAGGACATGGATTTCTATTACAAAC 58.163 37.037 0.00 0.00 0.00 2.93
29 30 7.713507 CGGTAGGACATGGATTTCTATTACAAA 59.286 37.037 0.00 0.00 0.00 2.83
30 31 7.070198 TCGGTAGGACATGGATTTCTATTACAA 59.930 37.037 0.00 0.00 0.00 2.41
31 32 6.551975 TCGGTAGGACATGGATTTCTATTACA 59.448 38.462 0.00 0.00 0.00 2.41
484 485 8.933653 TGTTGTGTTGAAGGGATATCTATATGA 58.066 33.333 2.05 0.00 0.00 2.15
1256 2866 5.495640 TGGTATAAATTCGTAAACCGGGTT 58.504 37.500 10.96 10.96 37.11 4.11
2241 5142 6.429385 CCAATTTTTGGTATAGCTTTTGCCAA 59.571 34.615 12.77 12.77 45.81 4.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.