Multiple sequence alignment - TraesCS1D01G128200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G128200 chr1D 100.000 2483 0 0 1 2483 141316693 141319175 0 4586
1 TraesCS1D01G128200 chr7D 99.517 2484 11 1 1 2483 381958719 381961202 0 4519
2 TraesCS1D01G128200 chr7D 99.436 2484 13 1 1 2483 382065120 382062637 0 4508
3 TraesCS1D01G128200 chr7D 99.155 2485 18 3 1 2483 626682793 626685276 0 4470
4 TraesCS1D01G128200 chr7D 98.954 2485 22 3 1 2483 203515035 203512553 0 4442
5 TraesCS1D01G128200 chr7D 97.143 420 12 0 1 420 306895788 306895369 0 710
6 TraesCS1D01G128200 chr6D 99.517 2484 11 1 1 2483 124532564 124530081 0 4519
7 TraesCS1D01G128200 chr7B 99.276 2485 16 1 1 2483 644463886 644461402 0 4488
8 TraesCS1D01G128200 chrUn 99.236 2487 15 3 1 2483 189407526 189405040 0 4484
9 TraesCS1D01G128200 chr6B 98.431 2485 27 6 1 2483 306999548 307002022 0 4362
10 TraesCS1D01G128200 chr5A 98.137 2147 39 1 338 2483 157783623 157781477 0 3742


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G128200 chr1D 141316693 141319175 2482 False 4586 4586 100.000 1 2483 1 chr1D.!!$F1 2482
1 TraesCS1D01G128200 chr7D 381958719 381961202 2483 False 4519 4519 99.517 1 2483 1 chr7D.!!$F1 2482
2 TraesCS1D01G128200 chr7D 382062637 382065120 2483 True 4508 4508 99.436 1 2483 1 chr7D.!!$R3 2482
3 TraesCS1D01G128200 chr7D 626682793 626685276 2483 False 4470 4470 99.155 1 2483 1 chr7D.!!$F2 2482
4 TraesCS1D01G128200 chr7D 203512553 203515035 2482 True 4442 4442 98.954 1 2483 1 chr7D.!!$R1 2482
5 TraesCS1D01G128200 chr6D 124530081 124532564 2483 True 4519 4519 99.517 1 2483 1 chr6D.!!$R1 2482
6 TraesCS1D01G128200 chr7B 644461402 644463886 2484 True 4488 4488 99.276 1 2483 1 chr7B.!!$R1 2482
7 TraesCS1D01G128200 chrUn 189405040 189407526 2486 True 4484 4484 99.236 1 2483 1 chrUn.!!$R1 2482
8 TraesCS1D01G128200 chr6B 306999548 307002022 2474 False 4362 4362 98.431 1 2483 1 chr6B.!!$F1 2482
9 TraesCS1D01G128200 chr5A 157781477 157783623 2146 True 3742 3742 98.137 338 2483 1 chr5A.!!$R1 2145

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
797 798 1.361668 CGCAACAATAGAGCAGGCGT 61.362 55.0 0.0 0.0 38.36 5.68 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2327 2338 3.149196 CACTAGCATTGGACCAACAGTT 58.851 45.455 9.67 6.09 0.0 3.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
357 358 7.041644 CGTATTGAAAAGGTTCCTAAGACACAA 60.042 37.037 0.00 0.0 32.28 3.33
797 798 1.361668 CGCAACAATAGAGCAGGCGT 61.362 55.000 0.00 0.0 38.36 5.68
1098 1099 6.855914 CGAAGAAATTTCGAACAAAAGGATCA 59.144 34.615 12.42 0.0 43.97 2.92
1507 1512 5.874810 CCTCTTCGTTTTGAGACATTATGGA 59.125 40.000 0.00 0.0 32.44 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
357 358 8.868522 TTCTGAATATTTTGACTCTTCCATGT 57.131 30.769 0.00 0.00 0.0 3.21
797 798 0.531532 CAAACATTTTGTGGGCGGCA 60.532 50.000 12.47 0.00 0.0 5.69
1098 1099 3.366396 TCCTTTCCTATCAGCGAGTTCT 58.634 45.455 0.00 0.00 0.0 3.01
2327 2338 3.149196 CACTAGCATTGGACCAACAGTT 58.851 45.455 9.67 6.09 0.0 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.