Multiple sequence alignment - TraesCS1D01G128100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G128100 chr1D 100.000 2636 0 0 1 2636 141317645 141315010 0 4868
1 TraesCS1D01G128100 chrUn 99.242 2638 15 4 1 2636 189406574 189409208 0 4756
2 TraesCS1D01G128100 chrUn 98.939 2638 22 4 1 2636 251410021 251407388 0 4711
3 TraesCS1D01G128100 chr6D 99.052 2637 20 3 1 2636 124531612 124534244 0 4726
4 TraesCS1D01G128100 chr7D 98.862 2637 24 4 1 2636 626683745 626681114 0 4698
5 TraesCS1D01G128100 chr7B 98.749 2638 28 4 1 2636 644462934 644465568 0 4684
6 TraesCS1D01G128100 chr1B 98.560 2638 32 4 1 2636 668809669 668807036 0 4656
7 TraesCS1D01G128100 chr1B 98.522 2638 33 5 1 2636 638705174 638702541 0 4650
8 TraesCS1D01G128100 chr1B 98.218 2638 42 4 1 2636 672474652 672477286 0 4606
9 TraesCS1D01G128100 chr3A 98.446 2638 35 5 1 2636 633106746 633109379 0 4639


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G128100 chr1D 141315010 141317645 2635 True 4868 4868 100.000 1 2636 1 chr1D.!!$R1 2635
1 TraesCS1D01G128100 chrUn 189406574 189409208 2634 False 4756 4756 99.242 1 2636 1 chrUn.!!$F1 2635
2 TraesCS1D01G128100 chrUn 251407388 251410021 2633 True 4711 4711 98.939 1 2636 1 chrUn.!!$R1 2635
3 TraesCS1D01G128100 chr6D 124531612 124534244 2632 False 4726 4726 99.052 1 2636 1 chr6D.!!$F1 2635
4 TraesCS1D01G128100 chr7D 626681114 626683745 2631 True 4698 4698 98.862 1 2636 1 chr7D.!!$R1 2635
5 TraesCS1D01G128100 chr7B 644462934 644465568 2634 False 4684 4684 98.749 1 2636 1 chr7B.!!$F1 2635
6 TraesCS1D01G128100 chr1B 668807036 668809669 2633 True 4656 4656 98.560 1 2636 1 chr1B.!!$R2 2635
7 TraesCS1D01G128100 chr1B 638702541 638705174 2633 True 4650 4650 98.522 1 2636 1 chr1B.!!$R1 2635
8 TraesCS1D01G128100 chr1B 672474652 672477286 2634 False 4606 4606 98.218 1 2636 1 chr1B.!!$F1 2635
9 TraesCS1D01G128100 chr3A 633106746 633109379 2633 False 4639 4639 98.446 1 2636 1 chr3A.!!$F1 2635

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
155 156 0.531532 CAAACATTTTGTGGGCGGCA 60.532 50.0 12.47 0.0 0.00 5.69 F
1150 1153 1.567357 CCCTGGTACCCCCAAAATTG 58.433 55.0 10.07 0.0 44.65 2.32 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1490 1493 0.108585 ATGAAACCCGCGATGGCTAT 59.891 50.000 8.23 0.0 36.88 2.97 R
1968 1974 3.067180 CAGCAAGCAGAAAAAGGACTGAA 59.933 43.478 0.00 0.0 36.38 3.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
155 156 0.531532 CAAACATTTTGTGGGCGGCA 60.532 50.000 12.47 0.00 0.00 5.69
1093 1096 4.378459 CCTCACAATCTTCAGTTTTACGCC 60.378 45.833 0.00 0.00 0.00 5.68
1150 1153 1.567357 CCCTGGTACCCCCAAAATTG 58.433 55.000 10.07 0.00 44.65 2.32
1424 1427 4.358851 CGAGCTTGGATAGAACTGAAGAG 58.641 47.826 0.00 0.00 0.00 2.85
1707 1712 5.596836 TTTTGTTGAGGATCTTGCACTTT 57.403 34.783 0.00 0.00 34.92 2.66
1968 1974 4.148825 CTAGCGCGCCCCAAGACT 62.149 66.667 30.33 9.26 0.00 3.24
2075 2081 7.093322 AGAAATGAGCAAGACCATATGTTTC 57.907 36.000 1.24 1.59 0.00 2.78
2625 2632 1.467920 GCTTCAGGCCATAGTGCTTT 58.532 50.000 5.01 0.00 34.27 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
155 156 1.361668 CGCAACAATAGAGCAGGCGT 61.362 55.000 0.00 0.0 38.36 5.68
1093 1096 5.875359 AGAACATTTCTTCCCTTAAGCGTAG 59.125 40.000 0.00 0.0 36.36 3.51
1150 1153 3.812053 CCTGTAAGCTCATCTTGCATACC 59.188 47.826 0.00 0.0 44.47 2.73
1424 1427 2.981400 TTTCTTCGTTCGCCAAATCC 57.019 45.000 0.00 0.0 0.00 3.01
1490 1493 0.108585 ATGAAACCCGCGATGGCTAT 59.891 50.000 8.23 0.0 36.88 2.97
1707 1712 5.493809 GCTATGTAAATATAGGGCCGGAAA 58.506 41.667 5.05 0.0 32.47 3.13
1968 1974 3.067180 CAGCAAGCAGAAAAAGGACTGAA 59.933 43.478 0.00 0.0 36.38 3.02
2075 2081 9.232473 GGTTTATATAGGGGCTCTATTTTTGAG 57.768 37.037 13.05 0.0 39.30 3.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.