Multiple sequence alignment - TraesCS1D01G127100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G127100 chr1D 100.000 2892 0 0 1 2892 139531060 139528169 0 5341
1 TraesCS1D01G127100 chr1D 98.444 2892 42 1 1 2892 127109706 127106818 0 5088
2 TraesCS1D01G127100 chr1D 97.547 2894 68 2 1 2892 285592197 285589305 0 4948
3 TraesCS1D01G127100 chr3D 97.993 2890 56 2 3 2892 62303670 62300783 0 5014
4 TraesCS1D01G127100 chr3D 97.237 2895 75 3 1 2892 414062275 414065167 0 4898
5 TraesCS1D01G127100 chr3D 97.204 2897 70 5 1 2892 153262247 153265137 0 4891
6 TraesCS1D01G127100 chr6D 97.547 2894 64 5 1 2892 422856344 422859232 0 4944
7 TraesCS1D01G127100 chr7D 97.341 2896 65 10 1 2892 156228950 156231837 0 4911
8 TraesCS1D01G127100 chr7D 97.304 2893 71 5 2 2892 165322675 165325562 0 4903
9 TraesCS1D01G127100 chr5D 97.167 2894 79 3 1 2892 109750954 109753846 0 4887


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G127100 chr1D 139528169 139531060 2891 True 5341 5341 100.000 1 2892 1 chr1D.!!$R2 2891
1 TraesCS1D01G127100 chr1D 127106818 127109706 2888 True 5088 5088 98.444 1 2892 1 chr1D.!!$R1 2891
2 TraesCS1D01G127100 chr1D 285589305 285592197 2892 True 4948 4948 97.547 1 2892 1 chr1D.!!$R3 2891
3 TraesCS1D01G127100 chr3D 62300783 62303670 2887 True 5014 5014 97.993 3 2892 1 chr3D.!!$R1 2889
4 TraesCS1D01G127100 chr3D 414062275 414065167 2892 False 4898 4898 97.237 1 2892 1 chr3D.!!$F2 2891
5 TraesCS1D01G127100 chr3D 153262247 153265137 2890 False 4891 4891 97.204 1 2892 1 chr3D.!!$F1 2891
6 TraesCS1D01G127100 chr6D 422856344 422859232 2888 False 4944 4944 97.547 1 2892 1 chr6D.!!$F1 2891
7 TraesCS1D01G127100 chr7D 156228950 156231837 2887 False 4911 4911 97.341 1 2892 1 chr7D.!!$F1 2891
8 TraesCS1D01G127100 chr7D 165322675 165325562 2887 False 4903 4903 97.304 2 2892 1 chr7D.!!$F2 2890
9 TraesCS1D01G127100 chr5D 109750954 109753846 2892 False 4887 4887 97.167 1 2892 1 chr5D.!!$F1 2891

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
387 390 3.219281 GGGAAAAGTGCACAAACCTCTA 58.781 45.455 21.04 0.0 0.0 2.43 F
1086 1089 1.170919 ACGCTGACTGTAGGACACGT 61.171 55.000 0.00 0.0 0.0 4.49 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1326 1329 1.180456 TGGCGTGAACGTCCTTCCTA 61.18 55.0 4.83 0.0 44.42 2.94 R
2109 2116 1.240256 CGGTGGGAAAACAAATCCGA 58.76 50.0 0.00 0.0 38.96 4.55 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
146 147 9.298250 CTCAAAGGGATCATGAGATTATTCATT 57.702 33.333 0.09 0.00 42.48 2.57
335 337 5.334028 CGTTTCTCAAACATCATGTAGTGCA 60.334 40.000 0.00 0.00 41.44 4.57
387 390 3.219281 GGGAAAAGTGCACAAACCTCTA 58.781 45.455 21.04 0.00 0.00 2.43
1003 1006 2.374504 AGCATTACTGATCCAGGGATGG 59.625 50.000 5.35 1.28 35.51 3.51
1086 1089 1.170919 ACGCTGACTGTAGGACACGT 61.171 55.000 0.00 0.00 0.00 4.49
1203 1206 2.171237 TCATGCAACCGGATGAAGAGAT 59.829 45.455 17.00 0.00 45.83 2.75
1251 1254 5.008331 AGTCACTAAGTACCTGAACATCGA 58.992 41.667 0.00 0.00 0.00 3.59
1326 1329 5.240403 GCTGGAAGATTCAAGTTCAAGTTCT 59.760 40.000 0.00 0.00 34.07 3.01
1434 1437 2.700371 ACATCTCTATGGGACGCATTGA 59.300 45.455 10.59 12.67 37.43 2.57
1662 1666 1.337823 GGAAGAACTCAAGGCTACGCA 60.338 52.381 0.00 0.00 0.00 5.24
1867 1871 1.674221 GCTGGAGCCGATATCATGGAC 60.674 57.143 3.12 0.00 34.31 4.02
2042 2048 5.155161 TGAGCATATGGGTAGTGTATCCTT 58.845 41.667 4.56 0.00 0.00 3.36
2109 2116 4.194720 GCCTCCGAGACGCGACAT 62.195 66.667 15.93 0.00 44.57 3.06
2621 2645 0.742281 CGTTGCTACAGATGCAGCCT 60.742 55.000 0.00 0.00 41.71 4.58
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
146 147 2.866460 GCTGCACACGGAAGTTTCTAGA 60.866 50.000 0.00 0.00 46.40 2.43
335 337 0.179000 ATCGCCTCCGCTTGATTCTT 59.821 50.000 0.00 0.00 0.00 2.52
387 390 7.187824 ACCATGATTAGATTGTACACTCTGT 57.812 36.000 22.25 12.63 0.00 3.41
422 425 3.104512 ACTCAAGATGTCCATAACCGGA 58.895 45.455 9.46 0.00 0.00 5.14
1024 1027 1.663695 CGACCAGACCACAAACAGTT 58.336 50.000 0.00 0.00 0.00 3.16
1033 1036 0.320374 CCTTTGTAGCGACCAGACCA 59.680 55.000 0.00 0.00 0.00 4.02
1086 1089 5.544948 TGTTCTAGGGTTTAAGCTTAGTGGA 59.455 40.000 11.90 0.00 0.00 4.02
1203 1206 3.823281 TCAAGTGTCGTCCAAAAGGTA 57.177 42.857 0.00 0.00 0.00 3.08
1251 1254 2.817844 GTTCCGGTGAAGCTTGGTATTT 59.182 45.455 2.10 0.00 0.00 1.40
1326 1329 1.180456 TGGCGTGAACGTCCTTCCTA 61.180 55.000 4.83 0.00 44.42 2.94
1434 1437 3.243724 AGCTCCTTGTGGTAGACTTCTT 58.756 45.455 0.00 0.00 34.23 2.52
1662 1666 3.816398 TCTCCTCCTCATATCCATCGT 57.184 47.619 0.00 0.00 0.00 3.73
1867 1871 4.238514 AGAAGTTTTGATCGGTCGAAGAG 58.761 43.478 0.00 0.00 36.95 2.85
2109 2116 1.240256 CGGTGGGAAAACAAATCCGA 58.760 50.000 0.00 0.00 38.96 4.55
2621 2645 3.261897 CCTTCCAGAAACTTCTCCTGCTA 59.738 47.826 0.00 0.00 34.74 3.49


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.