Multiple sequence alignment - TraesCS1D01G118400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G118400 chr1D 100.000 2496 0 0 1 2496 114160191 114162686 0.000000e+00 4610
1 TraesCS1D01G118400 chr1D 99.056 2119 18 2 379 2496 316336802 316334685 0.000000e+00 3801
2 TraesCS1D01G118400 chrUn 98.157 2496 41 3 1 2496 22559590 22557100 0.000000e+00 4349
3 TraesCS1D01G118400 chr7B 96.084 2298 85 5 162 2456 669032966 669030671 0.000000e+00 3740
4 TraesCS1D01G118400 chr7B 96.084 2298 85 5 162 2456 669051617 669049322 0.000000e+00 3740
5 TraesCS1D01G118400 chr7B 95.997 2298 87 5 162 2456 669068884 669066589 0.000000e+00 3729
6 TraesCS1D01G118400 chr7B 91.038 1272 84 17 2 1256 112122661 112123919 0.000000e+00 1690
7 TraesCS1D01G118400 chr2D 98.718 1482 15 3 1 1482 590231748 590233225 0.000000e+00 2628
8 TraesCS1D01G118400 chr2D 95.385 65 0 1 2047 2108 555163498 555163434 1.580000e-17 100
9 TraesCS1D01G118400 chr2B 90.959 1272 85 17 2 1256 22677998 22679256 0.000000e+00 1685
10 TraesCS1D01G118400 chr2B 89.510 1020 78 10 1258 2269 713549940 713550938 0.000000e+00 1264
11 TraesCS1D01G118400 chr2B 95.217 230 11 0 2267 2496 713673122 713673351 5.070000e-97 364
12 TraesCS1D01G118400 chr2B 90.995 211 15 3 2286 2496 272486749 272486955 5.260000e-72 281
13 TraesCS1D01G118400 chr2B 90.654 214 16 3 2286 2496 281936757 281936545 5.260000e-72 281
14 TraesCS1D01G118400 chr3B 90.809 1273 86 19 2 1256 809803067 809804326 0.000000e+00 1674
15 TraesCS1D01G118400 chr3B 82.122 688 95 13 1425 2108 302551585 302552248 4.660000e-157 564
16 TraesCS1D01G118400 chr5B 90.659 1274 87 17 2 1256 643124332 643123072 0.000000e+00 1664
17 TraesCS1D01G118400 chr5B 88.140 430 39 4 841 1258 106810520 106810091 3.710000e-138 501
18 TraesCS1D01G118400 chr6A 90.755 649 42 7 619 1256 584479183 584479824 0.000000e+00 850
19 TraesCS1D01G118400 chr7A 84.715 386 45 9 1728 2108 11423462 11423838 8.430000e-100 374
20 TraesCS1D01G118400 chr1B 83.690 374 47 12 1728 2099 637559622 637559261 8.550000e-90 340
21 TraesCS1D01G118400 chr4A 90.521 211 19 1 2286 2496 728683115 728683324 6.800000e-71 278


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G118400 chr1D 114160191 114162686 2495 False 4610 4610 100.000 1 2496 1 chr1D.!!$F1 2495
1 TraesCS1D01G118400 chr1D 316334685 316336802 2117 True 3801 3801 99.056 379 2496 1 chr1D.!!$R1 2117
2 TraesCS1D01G118400 chrUn 22557100 22559590 2490 True 4349 4349 98.157 1 2496 1 chrUn.!!$R1 2495
3 TraesCS1D01G118400 chr7B 669030671 669032966 2295 True 3740 3740 96.084 162 2456 1 chr7B.!!$R1 2294
4 TraesCS1D01G118400 chr7B 669049322 669051617 2295 True 3740 3740 96.084 162 2456 1 chr7B.!!$R2 2294
5 TraesCS1D01G118400 chr7B 669066589 669068884 2295 True 3729 3729 95.997 162 2456 1 chr7B.!!$R3 2294
6 TraesCS1D01G118400 chr7B 112122661 112123919 1258 False 1690 1690 91.038 2 1256 1 chr7B.!!$F1 1254
7 TraesCS1D01G118400 chr2D 590231748 590233225 1477 False 2628 2628 98.718 1 1482 1 chr2D.!!$F1 1481
8 TraesCS1D01G118400 chr2B 22677998 22679256 1258 False 1685 1685 90.959 2 1256 1 chr2B.!!$F1 1254
9 TraesCS1D01G118400 chr2B 713549940 713550938 998 False 1264 1264 89.510 1258 2269 1 chr2B.!!$F3 1011
10 TraesCS1D01G118400 chr3B 809803067 809804326 1259 False 1674 1674 90.809 2 1256 1 chr3B.!!$F2 1254
11 TraesCS1D01G118400 chr3B 302551585 302552248 663 False 564 564 82.122 1425 2108 1 chr3B.!!$F1 683
12 TraesCS1D01G118400 chr5B 643123072 643124332 1260 True 1664 1664 90.659 2 1256 1 chr5B.!!$R2 1254
13 TraesCS1D01G118400 chr6A 584479183 584479824 641 False 850 850 90.755 619 1256 1 chr6A.!!$F1 637

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
96 97 5.977725 GGAAAAACTACAGTTCAAAGCCTTC 59.022 40.0 0.0 0.0 37.25 3.46 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1770 1801 1.300963 GTGGCAGGAAGGAGCATCA 59.699 57.895 0.0 0.0 36.25 3.07 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
96 97 5.977725 GGAAAAACTACAGTTCAAAGCCTTC 59.022 40.000 0.00 0.0 37.25 3.46
117 118 7.761249 GCCTTCTATAAAATGCATGTCACTTTT 59.239 33.333 0.00 0.0 0.00 2.27
1378 1404 8.776470 CATTCCTTTTTGTGCTTTATGTGATTT 58.224 29.630 0.00 0.0 0.00 2.17
1726 1757 2.283676 GTCTCCGTCCCTCCACCA 60.284 66.667 0.00 0.0 0.00 4.17
1770 1801 2.323999 TCAAGCCCAACCAAATGGAT 57.676 45.000 6.42 0.0 43.54 3.41
2176 2215 5.419788 TCTCATTGCCTCTATTTGTTTGCAT 59.580 36.000 0.00 0.0 0.00 3.96
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1000 1022 2.656069 CCCCGGTCGTCCACTTCAT 61.656 63.158 0.00 0.00 0.00 2.57
1378 1404 6.915544 TTGCATGCATTAGAACAAAAACAA 57.084 29.167 23.37 0.00 0.00 2.83
1726 1757 3.585990 GTGTGTGTGCCGCTGCTT 61.586 61.111 0.70 0.00 38.71 3.91
1770 1801 1.300963 GTGGCAGGAAGGAGCATCA 59.699 57.895 0.00 0.00 36.25 3.07
2196 2236 9.448438 GGATATTCATACATGCAACCTGTAATA 57.552 33.333 2.92 0.29 33.12 0.98


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.