Multiple sequence alignment - TraesCS1D01G117500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G117500 chr1D 100.000 2327 0 0 1 2327 113909456 113907130 0 4298
1 TraesCS1D01G117500 chr1A 97.234 2350 28 17 1 2327 122501639 122499304 0 3945
2 TraesCS1D01G117500 chr1B 94.504 1492 36 12 861 2327 174107897 174109367 0 2259
3 TraesCS1D01G117500 chr1B 97.704 871 12 2 1 863 174106905 174107775 0 1491


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G117500 chr1D 113907130 113909456 2326 True 4298 4298 100.000 1 2327 1 chr1D.!!$R1 2326
1 TraesCS1D01G117500 chr1A 122499304 122501639 2335 True 3945 3945 97.234 1 2327 1 chr1A.!!$R1 2326
2 TraesCS1D01G117500 chr1B 174106905 174109367 2462 False 1875 2259 96.104 1 2327 2 chr1B.!!$F1 2326

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
651 660 9.007901 GGCAATATTCTGTTAGCTCTTGAATAT 57.992 33.333 13.62 13.62 40.12 1.28 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1497 1643 0.328258 AAGGAAGGTAGCAACGGCAT 59.672 50.0 0.0 0.0 44.61 4.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
651 660 9.007901 GGCAATATTCTGTTAGCTCTTGAATAT 57.992 33.333 13.62 13.62 40.12 1.28
1003 1137 6.113411 CGGAAGTAATACCAAAGGAAGATGT 58.887 40.000 0.00 0.00 0.00 3.06
1036 1170 5.591877 CAGAGATCTTCCCAAACATTTAGGG 59.408 44.000 0.00 0.00 44.22 3.53
1072 1206 1.063266 GTCTGATCTGGGAGGAGAGGT 60.063 57.143 0.00 0.00 0.00 3.85
1379 1515 1.207329 GAAGGTACTAGGGTGGTGCAG 59.793 57.143 0.00 0.00 38.49 4.41
1661 1809 3.349022 TGCTGATTGCTGATCATTGTCA 58.651 40.909 0.00 0.00 43.59 3.58
1662 1810 3.951680 TGCTGATTGCTGATCATTGTCAT 59.048 39.130 0.00 0.00 43.59 3.06
1663 1811 4.401202 TGCTGATTGCTGATCATTGTCATT 59.599 37.500 0.00 0.00 43.59 2.57
1664 1812 4.740205 GCTGATTGCTGATCATTGTCATTG 59.260 41.667 0.00 0.00 43.59 2.82
1665 1813 5.678871 GCTGATTGCTGATCATTGTCATTGT 60.679 40.000 0.00 0.00 43.59 2.71
1666 1814 5.886992 TGATTGCTGATCATTGTCATTGTC 58.113 37.500 0.00 0.00 39.83 3.18
2026 2177 8.999220 TCTAAATGATTTTGTTTGCATGCATA 57.001 26.923 23.37 14.80 0.00 3.14
2151 2309 2.761208 GTGATGTAGGCTACTGTGGACT 59.239 50.000 24.07 4.50 0.00 3.85
2223 2381 2.044123 ATGAAATCCTGACCTTCGGC 57.956 50.000 0.00 0.00 0.00 5.54
2230 2388 1.144936 CTGACCTTCGGCCATCCTC 59.855 63.158 2.24 0.00 0.00 3.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
190 197 1.275856 ACCAAGCTGAGCAGAGAAGAG 59.724 52.381 7.39 0.00 0.00 2.85
651 660 6.707440 AACACCATCTTGTTTGTTGTGATA 57.293 33.333 0.00 0.00 36.22 2.15
1003 1137 1.755959 GGAAGATCTCTGCAGCTCTGA 59.244 52.381 9.47 4.96 0.00 3.27
1036 1170 1.065854 CAGACCAGATGAACCAGACCC 60.066 57.143 0.00 0.00 0.00 4.46
1072 1206 5.013704 TCTGGTTCTGGTCTTTAGGCATAAA 59.986 40.000 3.23 3.23 0.00 1.40
1379 1515 8.669243 CCCTATTCTCAAACACTCAAAAGTATC 58.331 37.037 0.00 0.00 33.25 2.24
1497 1643 0.328258 AAGGAAGGTAGCAACGGCAT 59.672 50.000 0.00 0.00 44.61 4.40
1661 1809 5.219343 TCAGTGTCATGAACAGAGACAAT 57.781 39.130 0.00 9.60 43.16 2.71
1662 1810 4.670896 TCAGTGTCATGAACAGAGACAA 57.329 40.909 0.00 0.00 43.16 3.18
1663 1811 4.281688 TGATCAGTGTCATGAACAGAGACA 59.718 41.667 0.00 8.17 38.97 3.41
1664 1812 4.814147 TGATCAGTGTCATGAACAGAGAC 58.186 43.478 0.00 0.00 38.97 3.36
1807 1957 9.847224 AATTCACTAAGACAACTAGGAAAGAAA 57.153 29.630 0.00 0.00 0.00 2.52
2026 2177 8.815189 GTTGAAAAGTTAGACTTCGACTTAGTT 58.185 33.333 0.00 0.00 37.47 2.24
2151 2309 3.935818 TTAATGAAGTGGGCGGGATAA 57.064 42.857 0.00 0.00 0.00 1.75


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.