Multiple sequence alignment - TraesCS1D01G112200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G112200 chr1D 100.000 2663 0 0 1 2663 107599896 107602558 0.000000e+00 4918
1 TraesCS1D01G112200 chr1D 92.131 1004 57 5 979 1960 454864593 454863590 0.000000e+00 1397
2 TraesCS1D01G112200 chr1D 98.014 705 11 2 1961 2663 107608706 107609409 0.000000e+00 1221
3 TraesCS1D01G112200 chr6D 98.520 1960 29 0 1 1960 72038519 72036560 0.000000e+00 3459
4 TraesCS1D01G112200 chr6D 98.156 705 10 3 1961 2663 363398677 363397974 0.000000e+00 1227
5 TraesCS1D01G112200 chr6D 98.011 704 11 3 1961 2663 162265508 162266209 0.000000e+00 1219
6 TraesCS1D01G112200 chr6D 97.346 716 13 5 1951 2663 426895499 426896211 0.000000e+00 1212
7 TraesCS1D01G112200 chr7D 98.164 1961 35 1 1 1960 95071437 95073397 0.000000e+00 3421
8 TraesCS1D01G112200 chr7A 95.053 1981 76 5 1 1960 652173729 652171750 0.000000e+00 3096
9 TraesCS1D01G112200 chr4B 94.854 1982 80 5 1 1960 246309048 246311029 0.000000e+00 3075
10 TraesCS1D01G112200 chr5D 98.673 1507 20 0 454 1960 363187370 363185864 0.000000e+00 2673
11 TraesCS1D01G112200 chr4A 94.694 1225 45 1 756 1960 680333611 680332387 0.000000e+00 1884
12 TraesCS1D01G112200 chr4A 93.959 1225 53 1 757 1960 680343818 680342594 0.000000e+00 1832
13 TraesCS1D01G112200 chr7B 80.626 2013 309 48 8 1960 220296762 220294771 0.000000e+00 1482
14 TraesCS1D01G112200 chr2A 96.579 877 29 1 1084 1960 642732540 642733415 0.000000e+00 1452
15 TraesCS1D01G112200 chr1A 80.490 1999 302 49 25 1960 147691725 147689752 0.000000e+00 1450
16 TraesCS1D01G112200 chr2D 98.303 707 8 4 1961 2663 476270034 476270740 0.000000e+00 1236
17 TraesCS1D01G112200 chr2D 98.159 706 10 3 1961 2663 475470694 475471399 0.000000e+00 1229
18 TraesCS1D01G112200 chr2D 97.875 706 11 4 1961 2663 475477655 475478359 0.000000e+00 1218
19 TraesCS1D01G112200 chr3D 97.878 707 13 2 1958 2663 540042558 540043263 0.000000e+00 1221
20 TraesCS1D01G112200 chr3D 97.869 704 13 2 1961 2663 569493569 569492867 0.000000e+00 1216
21 TraesCS1D01G112200 chr2B 88.030 802 66 13 662 1440 217143685 217142891 0.000000e+00 922
22 TraesCS1D01G112200 chr6B 82.414 580 102 0 1 580 437911626 437912205 8.510000e-140 507
23 TraesCS1D01G112200 chrUn 80.563 355 56 5 443 795 479805445 479805788 7.310000e-66 261


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G112200 chr1D 107599896 107602558 2662 False 4918 4918 100.000 1 2663 1 chr1D.!!$F1 2662
1 TraesCS1D01G112200 chr1D 454863590 454864593 1003 True 1397 1397 92.131 979 1960 1 chr1D.!!$R1 981
2 TraesCS1D01G112200 chr1D 107608706 107609409 703 False 1221 1221 98.014 1961 2663 1 chr1D.!!$F2 702
3 TraesCS1D01G112200 chr6D 72036560 72038519 1959 True 3459 3459 98.520 1 1960 1 chr6D.!!$R1 1959
4 TraesCS1D01G112200 chr6D 363397974 363398677 703 True 1227 1227 98.156 1961 2663 1 chr6D.!!$R2 702
5 TraesCS1D01G112200 chr6D 162265508 162266209 701 False 1219 1219 98.011 1961 2663 1 chr6D.!!$F1 702
6 TraesCS1D01G112200 chr6D 426895499 426896211 712 False 1212 1212 97.346 1951 2663 1 chr6D.!!$F2 712
7 TraesCS1D01G112200 chr7D 95071437 95073397 1960 False 3421 3421 98.164 1 1960 1 chr7D.!!$F1 1959
8 TraesCS1D01G112200 chr7A 652171750 652173729 1979 True 3096 3096 95.053 1 1960 1 chr7A.!!$R1 1959
9 TraesCS1D01G112200 chr4B 246309048 246311029 1981 False 3075 3075 94.854 1 1960 1 chr4B.!!$F1 1959
10 TraesCS1D01G112200 chr5D 363185864 363187370 1506 True 2673 2673 98.673 454 1960 1 chr5D.!!$R1 1506
11 TraesCS1D01G112200 chr4A 680332387 680333611 1224 True 1884 1884 94.694 756 1960 1 chr4A.!!$R1 1204
12 TraesCS1D01G112200 chr4A 680342594 680343818 1224 True 1832 1832 93.959 757 1960 1 chr4A.!!$R2 1203
13 TraesCS1D01G112200 chr7B 220294771 220296762 1991 True 1482 1482 80.626 8 1960 1 chr7B.!!$R1 1952
14 TraesCS1D01G112200 chr2A 642732540 642733415 875 False 1452 1452 96.579 1084 1960 1 chr2A.!!$F1 876
15 TraesCS1D01G112200 chr1A 147689752 147691725 1973 True 1450 1450 80.490 25 1960 1 chr1A.!!$R1 1935
16 TraesCS1D01G112200 chr2D 476270034 476270740 706 False 1236 1236 98.303 1961 2663 1 chr2D.!!$F3 702
17 TraesCS1D01G112200 chr2D 475470694 475471399 705 False 1229 1229 98.159 1961 2663 1 chr2D.!!$F1 702
18 TraesCS1D01G112200 chr2D 475477655 475478359 704 False 1218 1218 97.875 1961 2663 1 chr2D.!!$F2 702
19 TraesCS1D01G112200 chr3D 540042558 540043263 705 False 1221 1221 97.878 1958 2663 1 chr3D.!!$F1 705
20 TraesCS1D01G112200 chr3D 569492867 569493569 702 True 1216 1216 97.869 1961 2663 1 chr3D.!!$R1 702
21 TraesCS1D01G112200 chr2B 217142891 217143685 794 True 922 922 88.030 662 1440 1 chr2B.!!$R1 778
22 TraesCS1D01G112200 chr6B 437911626 437912205 579 False 507 507 82.414 1 580 1 chr6B.!!$F1 579

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
904 985 1.629043 TTCTCCTACAACGGTGCTCT 58.371 50.0 0.0 0.0 0.0 4.09 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2247 2366 1.075305 TGCTGCTGCTGGATGGAAA 59.925 52.632 17.0 0.0 40.48 3.13 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
227 229 1.755179 CCGGCATCCAAGATCAAGTT 58.245 50.000 0.00 0.00 0.00 2.66
904 985 1.629043 TTCTCCTACAACGGTGCTCT 58.371 50.000 0.00 0.00 0.00 4.09
912 993 2.448582 AACGGTGCTCTGAACCCCA 61.449 57.895 0.68 0.00 33.88 4.96
1083 1164 2.249413 CTCCGCCTCTCCAGTGCAAT 62.249 60.000 0.00 0.00 0.00 3.56
1335 1429 2.649742 TGAGGATCTCCAAGGAAGGT 57.350 50.000 0.00 0.00 38.89 3.50
1341 1435 2.059756 TCTCCAAGGAAGGTGGGATT 57.940 50.000 0.00 0.00 36.73 3.01
1939 2058 2.986306 GCATCTGCTGTGCACCCAC 61.986 63.158 15.69 4.02 42.08 4.61
2115 2234 1.134560 GCGGATGAAGGAGTCGTACTT 59.865 52.381 0.00 0.00 0.00 2.24
2143 2262 3.694043 TTCAGATCACGGTTGATTCCA 57.306 42.857 0.00 0.00 42.95 3.53
2247 2366 0.547954 GAGGGAGAGGTTGGGGAAGT 60.548 60.000 0.00 0.00 0.00 3.01
2340 2459 2.042843 GCGGGAGAGGAGGAGGAA 60.043 66.667 0.00 0.00 0.00 3.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
327 329 4.388499 CCCTTGCGCCCGTACACT 62.388 66.667 4.18 0.0 0.00 3.55
648 650 2.131709 CCCATCCCGGCGTTCTCTA 61.132 63.158 6.01 0.0 0.00 2.43
991 1072 3.274586 CTGCATCATGGTCGGCGG 61.275 66.667 7.21 0.0 0.00 6.13
1083 1164 3.286751 GTTCGCTGCAGGTTGCCA 61.287 61.111 17.12 0.0 44.23 4.92
1335 1429 0.690192 TCCGTTGCAGAGAAATCCCA 59.310 50.000 0.00 0.0 0.00 4.37
1341 1435 0.391661 GCCTGATCCGTTGCAGAGAA 60.392 55.000 0.00 0.0 34.06 2.87
1939 2058 5.292765 ACATATTGATAGGCTGTTCTGTCG 58.707 41.667 0.00 0.0 0.00 4.35
2115 2234 1.749063 ACCGTGATCTGAATCGCTACA 59.251 47.619 0.00 0.0 39.74 2.74
2247 2366 1.075305 TGCTGCTGCTGGATGGAAA 59.925 52.632 17.00 0.0 40.48 3.13
2340 2459 2.699496 CAGCCCTACCCCTCTCCT 59.301 66.667 0.00 0.0 0.00 3.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.