Multiple sequence alignment - TraesCS1D01G103300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G103300 chr1D 100.000 3209 0 0 1 3209 92970665 92973873 0.000000e+00 5927
1 TraesCS1D01G103300 chr4A 97.649 3232 50 5 1 3209 241658931 241655703 0.000000e+00 5524
2 TraesCS1D01G103300 chr4A 93.125 1440 80 6 1 1439 477956994 477958415 0.000000e+00 2093
3 TraesCS1D01G103300 chr7B 97.399 3230 54 6 1 3209 355801848 355805068 0.000000e+00 5472
4 TraesCS1D01G103300 chr5B 97.331 3222 70 5 1 3209 46618021 46621239 0.000000e+00 5459
5 TraesCS1D01G103300 chr3B 97.195 3209 83 3 1 3209 96749066 96752267 0.000000e+00 5421
6 TraesCS1D01G103300 chr3D 97.227 3209 64 5 1 3209 229367593 229370776 0.000000e+00 5409
7 TraesCS1D01G103300 chr7A 97.574 2061 37 3 1153 3209 473899097 473901148 0.000000e+00 3517
8 TraesCS1D01G103300 chr2A 97.677 1765 39 1 1447 3209 608786368 608788132 0.000000e+00 3031
9 TraesCS1D01G103300 chr2A 97.938 1455 24 5 1 1455 608783177 608784625 0.000000e+00 2516
10 TraesCS1D01G103300 chr6D 94.071 1383 52 10 1 1356 41331339 41332718 0.000000e+00 2073
11 TraesCS1D01G103300 chr6D 90.101 596 57 2 1624 2218 41332776 41333370 0.000000e+00 773
12 TraesCS1D01G103300 chr4D 94.749 1333 52 4 1 1316 308695499 308696830 0.000000e+00 2058
13 TraesCS1D01G103300 chr4D 89.876 968 75 14 1390 2357 308696928 308697872 0.000000e+00 1223
14 TraesCS1D01G103300 chr4D 94.737 323 14 3 2346 2666 308741616 308741937 1.720000e-137 499
15 TraesCS1D01G103300 chr2B 92.826 1366 84 7 1 1356 324902463 324901102 0.000000e+00 1967
16 TraesCS1D01G103300 chr7D 95.018 542 26 1 2668 3209 199078727 199078187 0.000000e+00 850
17 TraesCS1D01G103300 chr7D 94.650 243 12 1 2428 2669 199078997 199078755 3.020000e-100 375
18 TraesCS1D01G103300 chr5D 89.377 546 32 7 2670 3209 558957936 558957411 0.000000e+00 664
19 TraesCS1D01G103300 chr1A 89.358 545 35 7 2668 3209 100684259 100684783 0.000000e+00 664


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G103300 chr1D 92970665 92973873 3208 False 5927.0 5927 100.0000 1 3209 1 chr1D.!!$F1 3208
1 TraesCS1D01G103300 chr4A 241655703 241658931 3228 True 5524.0 5524 97.6490 1 3209 1 chr4A.!!$R1 3208
2 TraesCS1D01G103300 chr4A 477956994 477958415 1421 False 2093.0 2093 93.1250 1 1439 1 chr4A.!!$F1 1438
3 TraesCS1D01G103300 chr7B 355801848 355805068 3220 False 5472.0 5472 97.3990 1 3209 1 chr7B.!!$F1 3208
4 TraesCS1D01G103300 chr5B 46618021 46621239 3218 False 5459.0 5459 97.3310 1 3209 1 chr5B.!!$F1 3208
5 TraesCS1D01G103300 chr3B 96749066 96752267 3201 False 5421.0 5421 97.1950 1 3209 1 chr3B.!!$F1 3208
6 TraesCS1D01G103300 chr3D 229367593 229370776 3183 False 5409.0 5409 97.2270 1 3209 1 chr3D.!!$F1 3208
7 TraesCS1D01G103300 chr7A 473899097 473901148 2051 False 3517.0 3517 97.5740 1153 3209 1 chr7A.!!$F1 2056
8 TraesCS1D01G103300 chr2A 608783177 608788132 4955 False 2773.5 3031 97.8075 1 3209 2 chr2A.!!$F1 3208
9 TraesCS1D01G103300 chr6D 41331339 41333370 2031 False 1423.0 2073 92.0860 1 2218 2 chr6D.!!$F1 2217
10 TraesCS1D01G103300 chr4D 308695499 308697872 2373 False 1640.5 2058 92.3125 1 2357 2 chr4D.!!$F2 2356
11 TraesCS1D01G103300 chr2B 324901102 324902463 1361 True 1967.0 1967 92.8260 1 1356 1 chr2B.!!$R1 1355
12 TraesCS1D01G103300 chr7D 199078187 199078997 810 True 612.5 850 94.8340 2428 3209 2 chr7D.!!$R1 781
13 TraesCS1D01G103300 chr5D 558957411 558957936 525 True 664.0 664 89.3770 2670 3209 1 chr5D.!!$R1 539
14 TraesCS1D01G103300 chr1A 100684259 100684783 524 False 664.0 664 89.3580 2668 3209 1 chr1A.!!$F1 541

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
329 332 1.017387 GCTTCTTTGCTCCATACCGG 58.983 55.0 0.0 0.0 0.0 5.28 F
1221 1303 0.889186 CGAGTGGTTTTGGGTGGGAG 60.889 60.0 0.0 0.0 0.0 4.30 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1908 3802 0.251832 TCCTCTTCTGTTCCTCGCCT 60.252 55.000 0.00 0.0 0.00 5.52 R
2536 4430 3.596310 TGTGCATGCAAAATATGTGCT 57.404 38.095 24.58 0.0 42.69 4.40 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
79 80 3.438781 TGTTTGTGACCGGAATATGAAGC 59.561 43.478 9.46 0.0 0.00 3.86
329 332 1.017387 GCTTCTTTGCTCCATACCGG 58.983 55.000 0.00 0.0 0.00 5.28
367 370 2.024414 GAAAGAATGGGCGGCTAATGT 58.976 47.619 9.56 0.0 0.00 2.71
955 1037 3.748083 TGCTTGCAGGAAGATATGGATC 58.252 45.455 5.73 0.0 32.82 3.36
1221 1303 0.889186 CGAGTGGTTTTGGGTGGGAG 60.889 60.000 0.00 0.0 0.00 4.30
1277 1359 1.995484 CGTGTGGAGCAACTATGTCAG 59.005 52.381 0.00 0.0 0.00 3.51
1417 1558 5.597182 CCTTCTCCATCATGATGTGGAATTT 59.403 40.000 29.23 0.0 43.52 1.82
1604 3496 4.177165 TGTGATTTTGCACCATGACATC 57.823 40.909 0.00 0.0 37.99 3.06
1628 3520 8.982091 TCAGTTACATCTTAGCTGTAGTCTAT 57.018 34.615 0.00 0.0 31.17 1.98
1908 3802 2.223688 CGCAACATCTTCAACCCAAACA 60.224 45.455 0.00 0.0 0.00 2.83
1937 3831 7.502060 AGGAACAGAAGAGGAAAAGATATCA 57.498 36.000 5.32 0.0 0.00 2.15
2094 3988 2.787473 TTGTGGGACTGGATGATGAC 57.213 50.000 0.00 0.0 0.00 3.06
2536 4430 4.525024 TGTCTCCCGAAACAAGGTTTTAA 58.475 39.130 0.00 0.0 0.00 1.52
3045 4981 7.477945 AAGAAATGAAGATCCTTGAGCAATT 57.522 32.000 0.00 0.0 0.00 2.32
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
79 80 6.884295 TCCCATCCAACTAAGACATACAAAAG 59.116 38.462 0.00 0.0 0.00 2.27
95 96 0.776810 TGCAGAACCTTCCCATCCAA 59.223 50.000 0.00 0.0 0.00 3.53
329 332 5.175859 TCTTTCAAATGGTATCGGACTGAC 58.824 41.667 0.00 0.0 0.00 3.51
367 370 6.843752 TCTCTTGGAGTTTGTGGGTTATTTA 58.156 36.000 0.00 0.0 0.00 1.40
417 420 8.602472 AAAGTTCTCTCTATCACATTCCTAGT 57.398 34.615 0.00 0.0 0.00 2.57
493 496 2.987149 GTGATACCTGATTCCGTATGCG 59.013 50.000 0.00 0.0 37.95 4.73
570 573 4.108336 CGGATCTGCGAGATGGTATTATG 58.892 47.826 3.76 0.0 34.53 1.90
627 630 6.011717 TCCATCTCTCTCTGCCTATCTCTTAT 60.012 42.308 0.00 0.0 0.00 1.73
955 1037 5.247337 AGTTTCTACCTCCTTTCTTCTCCAG 59.753 44.000 0.00 0.0 0.00 3.86
1277 1359 3.198872 GCTCAAGATGTAGTGCTTACCC 58.801 50.000 0.00 0.0 0.00 3.69
1417 1558 7.170658 GTGCATGTTTTCAAATAAACTTGGCTA 59.829 33.333 13.47 0.0 40.60 3.93
1527 3419 7.646314 CAAGTTGTGATTGTTTCTCAAGAGAT 58.354 34.615 0.00 0.0 38.23 2.75
1604 3496 8.841300 TCATAGACTACAGCTAAGATGTAACTG 58.159 37.037 2.40 0.0 32.96 3.16
1628 3520 6.713762 AACACACATCCAAAGAGAAAATCA 57.286 33.333 0.00 0.0 0.00 2.57
1711 3604 0.463620 TCTTTGTTTGCCTGCAACCC 59.536 50.000 3.64 0.0 35.46 4.11
1908 3802 0.251832 TCCTCTTCTGTTCCTCGCCT 60.252 55.000 0.00 0.0 0.00 5.52
1937 3831 4.458397 AGATGCAATTGAGTCATCCGATT 58.542 39.130 10.34 0.0 37.82 3.34
2387 4281 9.638176 AAACCTTCTATCATGCTAATCTCAAAT 57.362 29.630 0.00 0.0 0.00 2.32
2536 4430 3.596310 TGTGCATGCAAAATATGTGCT 57.404 38.095 24.58 0.0 42.69 4.40
2608 4504 5.426833 AGACTAATAATGCCACCTCTCAACT 59.573 40.000 0.00 0.0 0.00 3.16
3045 4981 8.593945 ATTAGCACCATCCAAGAAAGATTTTA 57.406 30.769 0.00 0.0 0.00 1.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.