Multiple sequence alignment - TraesCS1D01G092100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G092100 chr1D 100.000 2513 0 0 1 2513 78958015 78960527 0.000000e+00 4641.0
1 TraesCS1D01G092100 chr7D 98.172 2516 38 6 1 2513 86553897 86556407 0.000000e+00 4385.0
2 TraesCS1D01G092100 chr4D 98.093 2517 37 9 1 2513 167162843 167160334 0.000000e+00 4372.0
3 TraesCS1D01G092100 chr4D 97.829 2487 43 9 1 2481 9843253 9845734 0.000000e+00 4283.0
4 TraesCS1D01G092100 chr4D 97.507 2487 49 11 1 2481 403260739 403263218 0.000000e+00 4237.0
5 TraesCS1D01G092100 chr4D 100.000 35 0 0 2479 2513 532237 532271 5.800000e-07 65.8
6 TraesCS1D01G092100 chr4D 100.000 35 0 0 2479 2513 9845670 9845704 5.800000e-07 65.8
7 TraesCS1D01G092100 chr2D 97.933 2516 44 7 1 2513 408194613 408192103 0.000000e+00 4351.0
8 TraesCS1D01G092100 chr5D 98.029 2486 37 10 1 2481 543174274 543176752 0.000000e+00 4309.0
9 TraesCS1D01G092100 chr5D 97.507 2487 51 11 1 2481 411862990 411860509 0.000000e+00 4239.0
10 TraesCS1D01G092100 chr6D 97.667 2486 45 10 2 2481 77570295 77572773 0.000000e+00 4257.0
11 TraesCS1D01G092100 chr3D 97.467 2487 46 14 1 2481 357389676 357392151 0.000000e+00 4228.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G092100 chr1D 78958015 78960527 2512 False 4641.0 4641 100.0000 1 2513 1 chr1D.!!$F1 2512
1 TraesCS1D01G092100 chr7D 86553897 86556407 2510 False 4385.0 4385 98.1720 1 2513 1 chr7D.!!$F1 2512
2 TraesCS1D01G092100 chr4D 167160334 167162843 2509 True 4372.0 4372 98.0930 1 2513 1 chr4D.!!$R1 2512
3 TraesCS1D01G092100 chr4D 403260739 403263218 2479 False 4237.0 4237 97.5070 1 2481 1 chr4D.!!$F2 2480
4 TraesCS1D01G092100 chr4D 9843253 9845734 2481 False 2174.4 4283 98.9145 1 2513 2 chr4D.!!$F3 2512
5 TraesCS1D01G092100 chr2D 408192103 408194613 2510 True 4351.0 4351 97.9330 1 2513 1 chr2D.!!$R1 2512
6 TraesCS1D01G092100 chr5D 543174274 543176752 2478 False 4309.0 4309 98.0290 1 2481 1 chr5D.!!$F1 2480
7 TraesCS1D01G092100 chr5D 411860509 411862990 2481 True 4239.0 4239 97.5070 1 2481 1 chr5D.!!$R1 2480
8 TraesCS1D01G092100 chr6D 77570295 77572773 2478 False 4257.0 4257 97.6670 2 2481 1 chr6D.!!$F1 2479
9 TraesCS1D01G092100 chr3D 357389676 357392151 2475 False 4228.0 4228 97.4670 1 2481 1 chr3D.!!$F1 2480

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
530 542 0.320073 CCAAACCCTAGCGTCGAACA 60.32 55.0 0.0 0.0 0.0 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1867 1885 4.601406 TTATCCTTTGTGGGCCTATTGT 57.399 40.909 4.53 0.0 36.2 2.71 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
122 125 2.642807 CAAACCCTAAACCCTCTCTCCA 59.357 50.000 0.00 0.0 0.00 3.86
480 492 2.994581 TGGTCAAACCCTAATAACCCCA 59.005 45.455 0.00 0.0 37.50 4.96
530 542 0.320073 CCAAACCCTAGCGTCGAACA 60.320 55.000 0.00 0.0 0.00 3.18
880 895 3.006859 TCTCGAGCAATTCCTCTGTTTCA 59.993 43.478 7.81 0.0 0.00 2.69
1129 1144 1.480683 CGGAGGGGCAGGTTAGATCTA 60.481 57.143 0.00 0.0 0.00 1.98
1223 1239 7.646446 TTCGTTTTCAGATCGTGAAGAAATA 57.354 32.000 7.39 0.0 46.09 1.40
1229 1245 3.551890 CAGATCGTGAAGAAATACCACCG 59.448 47.826 0.00 0.0 0.00 4.94
1281 1297 0.480690 TTCAAGGGTTGGGCTTGCTA 59.519 50.000 0.00 0.0 0.00 3.49
1867 1885 2.357154 GGGCCCAAAGAGAATCAAGCTA 60.357 50.000 19.95 0.0 37.82 3.32
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
480 492 1.202533 CGGGGTTATGAGCGAGTCAAT 60.203 52.381 0.00 0.0 39.19 2.57
880 895 3.777522 AGAAGAACGAGAAGATGGGGAAT 59.222 43.478 0.00 0.0 0.00 3.01
1129 1144 5.501156 AGATAAAGGATGCGAGGAAAACTT 58.499 37.500 0.00 0.0 0.00 2.66
1229 1245 5.116180 TGTAATCATCCATCCACTCGAAAC 58.884 41.667 0.00 0.0 0.00 2.78
1281 1297 0.918983 TTGCATTCCCCCTCGAATCT 59.081 50.000 0.00 0.0 29.85 2.40
1867 1885 4.601406 TTATCCTTTGTGGGCCTATTGT 57.399 40.909 4.53 0.0 36.20 2.71
2069 2093 5.400066 TCGCTAGGCATAATAATACTGCA 57.600 39.130 0.00 0.0 37.64 4.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.