Multiple sequence alignment - TraesCS1D01G091900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G091900 chr1D 100.000 4144 0 0 1 4144 78392753 78396896 0.000000e+00 7653
1 TraesCS1D01G091900 chr2D 98.650 4147 43 7 1 4144 534506389 534502253 0.000000e+00 7336
2 TraesCS1D01G091900 chr3D 94.973 3342 134 8 832 4144 561020536 561017200 0.000000e+00 5210
3 TraesCS1D01G091900 chr3D 95.416 829 37 1 4 831 561021321 561020493 0.000000e+00 1319
4 TraesCS1D01G091900 chr2A 86.907 2108 258 16 888 2987 718358656 718356559 0.000000e+00 2348
5 TraesCS1D01G091900 chr2A 80.314 828 141 15 7 828 718359483 718358672 1.270000e-169 606
6 TraesCS1D01G091900 chr2A 81.391 575 95 7 2973 3543 718356370 718355804 3.780000e-125 459
7 TraesCS1D01G091900 chr5B 86.135 1868 243 14 885 2746 522084492 522086349 0.000000e+00 2001
8 TraesCS1D01G091900 chr5B 79.708 823 148 15 4 821 522083664 522084472 9.990000e-161 577


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G091900 chr1D 78392753 78396896 4143 False 7653.000000 7653 100.000000 1 4144 1 chr1D.!!$F1 4143
1 TraesCS1D01G091900 chr2D 534502253 534506389 4136 True 7336.000000 7336 98.650000 1 4144 1 chr2D.!!$R1 4143
2 TraesCS1D01G091900 chr3D 561017200 561021321 4121 True 3264.500000 5210 95.194500 4 4144 2 chr3D.!!$R1 4140
3 TraesCS1D01G091900 chr2A 718355804 718359483 3679 True 1137.666667 2348 82.870667 7 3543 3 chr2A.!!$R1 3536
4 TraesCS1D01G091900 chr5B 522083664 522086349 2685 False 1289.000000 2001 82.921500 4 2746 2 chr5B.!!$F1 2742

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
210 212 1.227823 CCAGGAACACCGTCAGCAA 60.228 57.895 0.0 0.0 0.00 3.91 F
1305 1312 0.251634 TCGGCATCCACATTACAGCA 59.748 50.000 0.0 0.0 0.00 4.41 F
1412 1422 2.430610 GCTGACCTCCTCGGATGCT 61.431 63.158 0.0 0.0 36.31 3.79 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1412 1422 0.539518 TTGTAGGAGGCGCTGCAATA 59.460 50.000 7.64 0.00 0.00 1.90 R
2584 2596 5.295152 TCATCTCATCCATTTCATCTGTCG 58.705 41.667 0.00 0.00 0.00 4.35 R
3680 3921 1.813513 ACTACTCCACAATGCAGTGC 58.186 50.000 15.18 8.58 38.18 4.40 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
210 212 1.227823 CCAGGAACACCGTCAGCAA 60.228 57.895 0.00 0.00 0.00 3.91
219 221 1.394917 CACCGTCAGCAAATCAGTAGC 59.605 52.381 0.00 0.00 0.00 3.58
856 862 6.852858 TTCGAAAACATGATGTTCACACTA 57.147 33.333 11.70 0.00 40.14 2.74
989 995 2.094675 CCATTGAACGGCCTCATCTTT 58.905 47.619 0.00 0.00 0.00 2.52
1157 1163 3.765026 AGGTAATTGCCGCAAAATTACG 58.235 40.909 10.42 0.00 45.33 3.18
1305 1312 0.251634 TCGGCATCCACATTACAGCA 59.748 50.000 0.00 0.00 0.00 4.41
1412 1422 2.430610 GCTGACCTCCTCGGATGCT 61.431 63.158 0.00 0.00 36.31 3.79
1782 1792 4.039609 AGACACTGAATCCATCGCATATCA 59.960 41.667 0.00 0.00 0.00 2.15
2584 2596 4.717313 GGTCCTGGACCCAACGGC 62.717 72.222 31.73 7.87 46.19 5.68
3101 3320 4.916983 TGTGACAATGAAAGGGAACAAG 57.083 40.909 0.00 0.00 0.00 3.16
3680 3921 1.971695 GGAACTTCGGGCCTTGGTG 60.972 63.158 0.84 0.00 0.00 4.17
3722 3963 1.067565 GTGACTCGATCTTCAGTGCCA 60.068 52.381 0.00 0.00 0.00 4.92
3796 4041 3.125316 CGGCAAAGTAGGACTTTTGCTAG 59.875 47.826 17.95 10.88 45.38 3.42
4068 4315 6.403333 TTTTCTGTGCTGTCGACATAATAC 57.597 37.500 20.40 15.17 0.00 1.89
4119 4366 7.749126 CGTGACCTAAAAAGGTTTGATTGTATC 59.251 37.037 0.00 0.00 43.24 2.24
4133 4380 0.031585 TGTATCGATTCGCGGGAAGG 59.968 55.000 20.13 14.10 41.33 3.46
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
210 212 0.620556 CCACACCCTGGCTACTGATT 59.379 55.000 0.00 0.00 31.36 2.57
219 221 3.996621 AATGCCCCCACACCCTGG 61.997 66.667 0.00 0.00 40.26 4.45
283 285 1.002990 TCCGACTCGTCACTGCCTA 60.003 57.895 0.00 0.00 0.00 3.93
989 995 2.669133 AACGCCATGCCAGCCTAGA 61.669 57.895 0.00 0.00 0.00 2.43
1157 1163 1.740025 GGGAGACAGTAAATGCACAGC 59.260 52.381 0.00 0.00 0.00 4.40
1305 1312 3.327757 TGAAGGTACATGAGGACAGCTTT 59.672 43.478 0.00 0.00 0.00 3.51
1412 1422 0.539518 TTGTAGGAGGCGCTGCAATA 59.460 50.000 7.64 0.00 0.00 1.90
1782 1792 1.786937 TGCCCAGTTTTGTGTCCATT 58.213 45.000 0.00 0.00 0.00 3.16
2009 2020 3.683365 AACCCATTTCCTGCATTTCAC 57.317 42.857 0.00 0.00 0.00 3.18
2584 2596 5.295152 TCATCTCATCCATTTCATCTGTCG 58.705 41.667 0.00 0.00 0.00 4.35
3680 3921 1.813513 ACTACTCCACAATGCAGTGC 58.186 50.000 15.18 8.58 38.18 4.40
3985 4231 7.064609 CACTTAGAGTATCGAAAAAGGCAATCA 59.935 37.037 0.00 0.00 42.67 2.57
4068 4315 2.294791 TCTTACCAAACCAAACATGGCG 59.705 45.455 0.00 0.00 37.77 5.69
4119 4366 0.459585 TCTTTCCTTCCCGCGAATCG 60.460 55.000 8.23 0.00 38.08 3.34


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.