Multiple sequence alignment - TraesCS1D01G087100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G087100 chr1D 100.000 3195 0 0 1 3195 72444201 72441007 0.000000e+00 5901
1 TraesCS1D01G087100 chr1D 99.116 2375 20 1 821 3195 72459788 72457415 0.000000e+00 4268
2 TraesCS1D01G087100 chr1D 96.848 825 21 4 1 824 72723296 72722476 0.000000e+00 1375
3 TraesCS1D01G087100 chr1D 96.727 825 26 1 1 824 358305180 358306004 0.000000e+00 1373
4 TraesCS1D01G087100 chr1D 81.416 1582 226 42 979 2507 72435177 72433611 0.000000e+00 1230
5 TraesCS1D01G087100 chr1D 84.215 1210 156 25 1018 2209 71769580 71768388 0.000000e+00 1144
6 TraesCS1D01G087100 chr1D 84.548 343 29 15 2242 2581 71768388 71768067 5.140000e-83 318
7 TraesCS1D01G087100 chr1B 83.918 2251 282 54 981 3195 113516231 113514025 0.000000e+00 2078
8 TraesCS1D01G087100 chr1B 80.726 1873 270 50 979 2807 113498640 113496815 0.000000e+00 1375
9 TraesCS1D01G087100 chr1B 80.619 1873 275 51 979 2807 113213491 113211663 0.000000e+00 1367
10 TraesCS1D01G087100 chr1B 80.566 1873 276 48 979 2807 113315852 113314024 0.000000e+00 1362
11 TraesCS1D01G087100 chr1B 86.089 1107 115 18 1001 2078 50992772 50993868 0.000000e+00 1155
12 TraesCS1D01G087100 chr1B 83.567 1211 151 34 1030 2209 113025832 113024639 0.000000e+00 1090
13 TraesCS1D01G087100 chr1B 88.273 469 40 8 2724 3190 51003270 51003725 6.030000e-152 547
14 TraesCS1D01G087100 chr1B 85.651 453 43 14 2063 2502 51002720 51003163 1.040000e-124 457
15 TraesCS1D01G087100 chr1B 77.945 730 92 36 2108 2807 113407749 113407059 2.990000e-105 392
16 TraesCS1D01G087100 chr1A 86.139 1378 154 20 1006 2363 32191443 32192803 0.000000e+00 1452
17 TraesCS1D01G087100 chr1A 93.333 75 5 0 828 902 405523153 405523079 9.370000e-21 111
18 TraesCS1D01G087100 chr2D 97.212 825 21 2 1 824 525414192 525413369 0.000000e+00 1395
19 TraesCS1D01G087100 chr2D 96.852 826 24 2 1 824 324442835 324443660 0.000000e+00 1380
20 TraesCS1D01G087100 chr4D 96.739 828 23 4 1 824 40518688 40519515 0.000000e+00 1376
21 TraesCS1D01G087100 chr4D 96.368 826 28 2 1 824 395849697 395850522 0.000000e+00 1358
22 TraesCS1D01G087100 chr4D 90.654 107 9 1 821 926 73405290 73405184 1.190000e-29 141
23 TraesCS1D01G087100 chr6D 96.731 826 25 2 1 824 99024637 99023812 0.000000e+00 1375
24 TraesCS1D01G087100 chr6D 96.735 827 24 3 1 824 334682189 334681363 0.000000e+00 1375
25 TraesCS1D01G087100 chr7D 96.493 827 26 3 1 824 540089800 540090626 0.000000e+00 1363
26 TraesCS1D01G087100 chrUn 82.732 1274 200 14 979 2238 372932933 372934200 0.000000e+00 1116


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G087100 chr1D 72441007 72444201 3194 True 5901 5901 100.0000 1 3195 1 chr1D.!!$R2 3194
1 TraesCS1D01G087100 chr1D 72457415 72459788 2373 True 4268 4268 99.1160 821 3195 1 chr1D.!!$R3 2374
2 TraesCS1D01G087100 chr1D 72722476 72723296 820 True 1375 1375 96.8480 1 824 1 chr1D.!!$R4 823
3 TraesCS1D01G087100 chr1D 358305180 358306004 824 False 1373 1373 96.7270 1 824 1 chr1D.!!$F1 823
4 TraesCS1D01G087100 chr1D 72433611 72435177 1566 True 1230 1230 81.4160 979 2507 1 chr1D.!!$R1 1528
5 TraesCS1D01G087100 chr1D 71768067 71769580 1513 True 731 1144 84.3815 1018 2581 2 chr1D.!!$R5 1563
6 TraesCS1D01G087100 chr1B 113514025 113516231 2206 True 2078 2078 83.9180 981 3195 1 chr1B.!!$R6 2214
7 TraesCS1D01G087100 chr1B 113496815 113498640 1825 True 1375 1375 80.7260 979 2807 1 chr1B.!!$R5 1828
8 TraesCS1D01G087100 chr1B 113211663 113213491 1828 True 1367 1367 80.6190 979 2807 1 chr1B.!!$R2 1828
9 TraesCS1D01G087100 chr1B 113314024 113315852 1828 True 1362 1362 80.5660 979 2807 1 chr1B.!!$R3 1828
10 TraesCS1D01G087100 chr1B 50992772 50993868 1096 False 1155 1155 86.0890 1001 2078 1 chr1B.!!$F1 1077
11 TraesCS1D01G087100 chr1B 113024639 113025832 1193 True 1090 1090 83.5670 1030 2209 1 chr1B.!!$R1 1179
12 TraesCS1D01G087100 chr1B 51002720 51003725 1005 False 502 547 86.9620 2063 3190 2 chr1B.!!$F2 1127
13 TraesCS1D01G087100 chr1B 113407059 113407749 690 True 392 392 77.9450 2108 2807 1 chr1B.!!$R4 699
14 TraesCS1D01G087100 chr1A 32191443 32192803 1360 False 1452 1452 86.1390 1006 2363 1 chr1A.!!$F1 1357
15 TraesCS1D01G087100 chr2D 525413369 525414192 823 True 1395 1395 97.2120 1 824 1 chr2D.!!$R1 823
16 TraesCS1D01G087100 chr2D 324442835 324443660 825 False 1380 1380 96.8520 1 824 1 chr2D.!!$F1 823
17 TraesCS1D01G087100 chr4D 40518688 40519515 827 False 1376 1376 96.7390 1 824 1 chr4D.!!$F1 823
18 TraesCS1D01G087100 chr4D 395849697 395850522 825 False 1358 1358 96.3680 1 824 1 chr4D.!!$F2 823
19 TraesCS1D01G087100 chr6D 99023812 99024637 825 True 1375 1375 96.7310 1 824 1 chr6D.!!$R1 823
20 TraesCS1D01G087100 chr6D 334681363 334682189 826 True 1375 1375 96.7350 1 824 1 chr6D.!!$R2 823
21 TraesCS1D01G087100 chr7D 540089800 540090626 826 False 1363 1363 96.4930 1 824 1 chr7D.!!$F1 823
22 TraesCS1D01G087100 chrUn 372932933 372934200 1267 False 1116 1116 82.7320 979 2238 1 chrUn.!!$F1 1259

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
819 827 1.153756 CCCCCAGGATAACCATGGC 59.846 63.158 13.04 0.0 38.94 4.40 F
1170 1186 1.417890 CTATGGCGGGTCTCCATTTCT 59.582 52.381 0.00 0.0 41.29 2.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2166 2276 0.603707 TGCTTCTGAAAGGGCGTCTG 60.604 55.000 0.0 0.0 36.26 3.51 R
2981 3126 1.681793 GCTGACTATACGGGAGCAAGA 59.318 52.381 0.0 0.0 0.00 3.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
57 58 1.523758 GAGGCATGGTGAAAACGAGT 58.476 50.000 0.00 0.0 0.00 4.18
586 589 6.059787 ACTTGTCAAGATAGGAAGCTGATT 57.940 37.500 19.53 0.0 0.00 2.57
819 827 1.153756 CCCCCAGGATAACCATGGC 59.846 63.158 13.04 0.0 38.94 4.40
984 992 2.129555 AAAGCCCGGCATGTCTCAGT 62.130 55.000 13.15 0.0 0.00 3.41
1170 1186 1.417890 CTATGGCGGGTCTCCATTTCT 59.582 52.381 0.00 0.0 41.29 2.52
1245 1261 4.790765 TCTGTCAGAGATTCGTGATGTT 57.209 40.909 0.00 0.0 0.00 2.71
2166 2276 6.055588 TCAGCTATTGTTTTGTAGATAGGGC 58.944 40.000 0.00 0.0 0.00 5.19
2409 2521 6.894339 TTATCCTTTCTTTTTCACCCAGAC 57.106 37.500 0.00 0.0 0.00 3.51
3181 3329 3.303495 CAGTGTCTTAATCGTACAAGCCG 59.697 47.826 0.00 0.0 0.00 5.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
165 167 1.625879 TAGGGGGAGAGGGAGAGCA 60.626 63.158 0.00 0.0 0.00 4.26
220 222 3.238497 CCCACGTCTCACCCCACA 61.238 66.667 0.00 0.0 0.00 4.17
586 589 2.180276 GGGTAGGAGTTGAGAAGCTCA 58.820 52.381 0.00 0.0 38.87 4.26
819 827 2.670148 CCTCCCTTCCCTTCCCACG 61.670 68.421 0.00 0.0 0.00 4.94
984 992 7.014905 AGGCTGTACATACGTATATTCCAAGAA 59.985 37.037 7.96 0.0 0.00 2.52
1170 1186 2.564504 CACCACAGAGAAGACATCCTCA 59.435 50.000 0.00 0.0 32.07 3.86
1999 2090 3.270027 GTCGGTCATCCATTTCATGTCA 58.730 45.455 0.00 0.0 0.00 3.58
2166 2276 0.603707 TGCTTCTGAAAGGGCGTCTG 60.604 55.000 0.00 0.0 36.26 3.51
2409 2521 7.043986 GCTCACAGTATAAGAAACTCACATACG 60.044 40.741 0.00 0.0 0.00 3.06
2981 3126 1.681793 GCTGACTATACGGGAGCAAGA 59.318 52.381 0.00 0.0 0.00 3.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.