Multiple sequence alignment - TraesCS1D01G084800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G084800 chr1D 100.000 2570 0 0 1 2570 69167073 69164504 0 4747
1 TraesCS1D01G084800 chr2D 98.135 2574 38 9 1 2570 552882402 552879835 0 4479
2 TraesCS1D01G084800 chr2D 97.376 1448 29 6 1 1442 304671649 304673093 0 2455
3 TraesCS1D01G084800 chr2D 98.199 944 11 5 1 939 395549364 395548422 0 1644
4 TraesCS1D01G084800 chr5D 98.152 2543 38 7 3 2540 27069257 27066719 0 4427
5 TraesCS1D01G084800 chr5D 97.326 2580 57 9 1 2570 406653869 406651292 0 4372
6 TraesCS1D01G084800 chr5D 98.354 1701 23 5 870 2570 543175087 543176782 0 2981
7 TraesCS1D01G084800 chr7D 97.248 2580 55 12 1 2570 207396145 207393572 0 4357
8 TraesCS1D01G084800 chr7D 97.665 1756 31 7 822 2570 207213075 207211323 0 3007
9 TraesCS1D01G084800 chr7D 97.379 992 20 5 1 987 207213948 207212958 0 1683
10 TraesCS1D01G084800 chr6D 97.631 2195 39 8 386 2570 102280032 102277841 0 3753
11 TraesCS1D01G084800 chr6D 98.120 1702 29 3 870 2570 77571104 77572803 0 2963
12 TraesCS1D01G084800 chr4D 98.179 1702 27 4 870 2570 9844066 9845764 0 2968
13 TraesCS1D01G084800 chr4D 97.886 946 8 10 1 939 529830 530770 0 1626


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G084800 chr1D 69164504 69167073 2569 True 4747 4747 100.000 1 2570 1 chr1D.!!$R1 2569
1 TraesCS1D01G084800 chr2D 552879835 552882402 2567 True 4479 4479 98.135 1 2570 1 chr2D.!!$R2 2569
2 TraesCS1D01G084800 chr2D 304671649 304673093 1444 False 2455 2455 97.376 1 1442 1 chr2D.!!$F1 1441
3 TraesCS1D01G084800 chr2D 395548422 395549364 942 True 1644 1644 98.199 1 939 1 chr2D.!!$R1 938
4 TraesCS1D01G084800 chr5D 27066719 27069257 2538 True 4427 4427 98.152 3 2540 1 chr5D.!!$R1 2537
5 TraesCS1D01G084800 chr5D 406651292 406653869 2577 True 4372 4372 97.326 1 2570 1 chr5D.!!$R2 2569
6 TraesCS1D01G084800 chr5D 543175087 543176782 1695 False 2981 2981 98.354 870 2570 1 chr5D.!!$F1 1700
7 TraesCS1D01G084800 chr7D 207393572 207396145 2573 True 4357 4357 97.248 1 2570 1 chr7D.!!$R1 2569
8 TraesCS1D01G084800 chr7D 207211323 207213948 2625 True 2345 3007 97.522 1 2570 2 chr7D.!!$R2 2569
9 TraesCS1D01G084800 chr6D 102277841 102280032 2191 True 3753 3753 97.631 386 2570 1 chr6D.!!$R1 2184
10 TraesCS1D01G084800 chr6D 77571104 77572803 1699 False 2963 2963 98.120 870 2570 1 chr6D.!!$F1 1700
11 TraesCS1D01G084800 chr4D 9844066 9845764 1698 False 2968 2968 98.179 870 2570 1 chr4D.!!$F2 1700
12 TraesCS1D01G084800 chr4D 529830 530770 940 False 1626 1626 97.886 1 939 1 chr4D.!!$F1 938

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
537 554 0.89972 TCCAAACCCTAGCGTCGAAT 59.1 50.0 0.0 0.0 0.0 3.34 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1904 2066 1.357079 AGCTTGATTCTCTTTGGGCCT 59.643 47.619 4.53 0.0 0.0 5.19 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
487 504 4.180723 TCTGGTCAAACCCTAATAACCCT 58.819 43.478 0.00 0.0 37.50 4.34
537 554 0.899720 TCCAAACCCTAGCGTCGAAT 59.100 50.000 0.00 0.0 0.00 3.34
563 580 1.814527 GTCGGATCCTACCAAGCGT 59.185 57.895 10.75 0.0 0.00 5.07
590 608 4.838152 CCCGTCAGATGTGGGGCG 62.838 72.222 5.36 0.0 39.39 6.13
1075 1237 1.565305 GATGACTCGATGCACTGACC 58.435 55.000 0.00 0.0 0.00 4.02
1324 1486 5.178096 TGATTACATCCAGAGGCTTCAAA 57.822 39.130 0.00 0.0 0.00 2.69
1512 1674 6.475504 TGAGTTGAAGAAGCAATCCAATCTA 58.524 36.000 0.00 0.0 0.00 1.98
1717 1879 3.997021 CAGTTTCGGCAGAAGACAACTAT 59.003 43.478 0.00 0.0 37.70 2.12
1878 2040 1.499049 ACTTTTGTCCTCGAGTTCGC 58.501 50.000 12.31 0.0 39.60 4.70
1904 2066 2.823747 TCTGCTAGAAACCTAGTTCGCA 59.176 45.455 0.00 0.0 36.78 5.10
2005 2170 2.568623 AGGAACGATTGCTTTGTCCT 57.431 45.000 0.00 0.0 0.00 3.85
2354 2528 1.143684 AGAGCTCTCAAACCAAAGCCA 59.856 47.619 11.45 0.0 35.32 4.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
487 504 1.066430 GGGGTTATGAGCGAGTCAACA 60.066 52.381 0.00 0.00 39.19 3.33
563 580 0.762418 ATCTGACGGGTGGTGTTTGA 59.238 50.000 0.00 0.00 0.00 2.69
689 707 2.643655 CATGTGGTGGTCATGTGCA 58.356 52.632 0.00 0.00 38.17 4.57
1324 1486 0.613012 GAATCCAGCAAGCCCAACCT 60.613 55.000 0.00 0.00 0.00 3.50
1512 1674 8.371699 CCTAGAGCAAGTATTCCTAAAGCTATT 58.628 37.037 0.00 0.00 0.00 1.73
1717 1879 9.739276 AACAAAATAATCCTATCACTGAACTGA 57.261 29.630 0.00 0.00 0.00 3.41
1878 2040 4.810191 ACTAGGTTTCTAGCAGAACTGG 57.190 45.455 3.99 0.44 45.20 4.00
1904 2066 1.357079 AGCTTGATTCTCTTTGGGCCT 59.643 47.619 4.53 0.00 0.00 5.19
2130 2302 7.470935 TGGTTCGCTAGGCATAATAATACTA 57.529 36.000 0.00 0.00 0.00 1.82
2238 2410 7.254852 TGGCTTTAGTCAAAAGTGTAGTTTTG 58.745 34.615 15.43 15.43 45.46 2.44
2298 2470 9.154632 AGGTATTCCAAGAATACTTTGGTTTTT 57.845 29.630 20.90 0.00 34.44 1.94
2431 2606 2.833121 GGCTAATTGGCGTGGGGG 60.833 66.667 7.78 0.00 0.00 5.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.