Multiple sequence alignment - TraesCS1D01G071700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G071700 chr1D 100.000 2211 0 0 1 2211 51921788 51923998 0 4084
1 TraesCS1D01G071700 chr1D 97.767 1791 40 0 420 2210 254393649 254395439 0 3086
2 TraesCS1D01G071700 chrUn 98.214 1792 32 0 420 2211 216514140 216515931 0 3133
3 TraesCS1D01G071700 chrUn 98.214 1792 32 0 420 2211 286269243 286267452 0 3133
4 TraesCS1D01G071700 chr3D 98.214 1792 31 1 420 2211 589272493 589274283 0 3131
5 TraesCS1D01G071700 chr5D 98.158 1792 33 0 420 2211 446178761 446176970 0 3127
6 TraesCS1D01G071700 chr5D 97.938 1794 35 1 420 2211 503222683 503220890 0 3107
7 TraesCS1D01G071700 chr5D 98.818 423 5 0 1 423 503223147 503222725 0 754
8 TraesCS1D01G071700 chr3B 98.053 1798 28 3 420 2211 101915643 101913847 0 3120
9 TraesCS1D01G071700 chr3B 99.054 423 4 0 1 423 101916107 101915685 0 760
10 TraesCS1D01G071700 chr1A 97.718 1797 35 2 420 2211 554516715 554514920 0 3086
11 TraesCS1D01G071700 chr3A 97.658 1793 38 3 420 2211 594895164 594896953 0 3075
12 TraesCS1D01G071700 chr3A 99.054 423 4 0 1 423 495094426 495094004 0 760
13 TraesCS1D01G071700 chr3A 98.818 423 5 0 1 423 66012694 66013116 0 754
14 TraesCS1D01G071700 chr7D 98.818 423 5 0 1 423 231578135 231578557 0 754
15 TraesCS1D01G071700 chr6D 98.818 423 5 0 1 423 168262597 168262175 0 754
16 TraesCS1D01G071700 chr6B 98.818 423 5 0 1 423 450088970 450088548 0 754
17 TraesCS1D01G071700 chr5A 98.818 423 5 0 1 423 510135565 510135987 0 754
18 TraesCS1D01G071700 chr4B 98.818 423 5 0 1 423 209114639 209115061 0 754


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G071700 chr1D 51921788 51923998 2210 False 4084.0 4084 100.0000 1 2211 1 chr1D.!!$F1 2210
1 TraesCS1D01G071700 chr1D 254393649 254395439 1790 False 3086.0 3086 97.7670 420 2210 1 chr1D.!!$F2 1790
2 TraesCS1D01G071700 chrUn 216514140 216515931 1791 False 3133.0 3133 98.2140 420 2211 1 chrUn.!!$F1 1791
3 TraesCS1D01G071700 chrUn 286267452 286269243 1791 True 3133.0 3133 98.2140 420 2211 1 chrUn.!!$R1 1791
4 TraesCS1D01G071700 chr3D 589272493 589274283 1790 False 3131.0 3131 98.2140 420 2211 1 chr3D.!!$F1 1791
5 TraesCS1D01G071700 chr5D 446176970 446178761 1791 True 3127.0 3127 98.1580 420 2211 1 chr5D.!!$R1 1791
6 TraesCS1D01G071700 chr5D 503220890 503223147 2257 True 1930.5 3107 98.3780 1 2211 2 chr5D.!!$R2 2210
7 TraesCS1D01G071700 chr3B 101913847 101916107 2260 True 1940.0 3120 98.5535 1 2211 2 chr3B.!!$R1 2210
8 TraesCS1D01G071700 chr1A 554514920 554516715 1795 True 3086.0 3086 97.7180 420 2211 1 chr1A.!!$R1 1791
9 TraesCS1D01G071700 chr3A 594895164 594896953 1789 False 3075.0 3075 97.6580 420 2211 1 chr3A.!!$F2 1791

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
423 469 0.327 AGGCCTTCCTCCACTAGCAT 60.327 55.0 0.0 0.0 38.72 3.79 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1387 1434 0.476338 AGATAGAGGAGAGCGCCAGA 59.524 55.0 2.29 0.0 0.0 3.86 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
195 196 7.122650 CCATAGGGCAAATCGGATATGTAATTT 59.877 37.037 0.00 0.00 0.00 1.82
313 314 8.719560 TGCATTGTATTATTTGGTCTACGTAA 57.280 30.769 0.00 0.00 0.00 3.18
423 469 0.327000 AGGCCTTCCTCCACTAGCAT 60.327 55.000 0.00 0.00 38.72 3.79
458 504 6.271391 TCTTGGTTTCAATAGGACTCCTTACA 59.729 38.462 1.94 0.00 34.61 2.41
664 710 5.163488 CCATTCTTGCAATTGCTCAGGATAA 60.163 40.000 29.37 15.66 42.66 1.75
819 865 8.568794 TCGACTCGATCATCAGATTATAAGTTT 58.431 33.333 0.00 0.00 33.72 2.66
885 932 2.872858 GGTCATTCGAGCCTATGGAAAC 59.127 50.000 0.00 0.00 33.34 2.78
979 1026 6.988580 CAGACCTGCTTTTGACATATCTATCA 59.011 38.462 0.00 0.00 0.00 2.15
1046 1093 7.072177 TGAATCGAGAAATTGGATTGTACAC 57.928 36.000 0.00 0.00 34.78 2.90
1387 1434 4.152284 GAAGTATTCCGGAAATCTGGGT 57.848 45.455 23.08 5.08 42.72 4.51
1615 1663 1.134699 CCAACCTCTATTGCTCTCGCA 60.135 52.381 0.00 0.00 46.24 5.10
1655 1704 3.059800 GTGACAGGAAAAAGTGACTACGC 60.060 47.826 0.00 0.00 0.00 4.42
1865 1919 4.379082 CCCGAATAAGAAAACAGAAACCGG 60.379 45.833 0.00 0.00 0.00 5.28
1888 1942 2.262423 AGAGGAAACCACAAGAGTGC 57.738 50.000 0.00 0.00 44.53 4.40
2115 2171 6.750660 TCCAAAAATGGGTACTATCGGATA 57.249 37.500 0.00 0.00 0.00 2.59
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
10 11 1.578423 GTGGCTGAAGCTGAAGCAC 59.422 57.895 19.42 12.80 45.16 4.40
159 160 3.417069 TTGCCCTATGGACGAATATGG 57.583 47.619 0.00 0.00 0.00 2.74
195 196 7.831691 TTGAGTCTCCAACAATTATTCCAAA 57.168 32.000 0.00 0.00 0.00 3.28
313 314 4.713824 TCTCGAATGTTATCAGTTCCGT 57.286 40.909 0.00 0.00 0.00 4.69
423 469 8.278639 TCCTATTGAAACCAAGAAATATAGGCA 58.721 33.333 0.00 0.00 0.00 4.75
510 556 5.650283 AGGGGTTATTTCTTGGTTTCATCA 58.350 37.500 0.00 0.00 0.00 3.07
597 643 9.700831 TGGTATAGTAGATGCTATCACACATAT 57.299 33.333 0.00 0.00 34.00 1.78
664 710 3.445987 AGACCTAGCAGCTAAAAGAGGT 58.554 45.455 12.90 12.90 40.01 3.85
819 865 2.363038 CGGTCTGGTTCGGTATGGAATA 59.637 50.000 0.00 0.00 0.00 1.75
885 932 8.091449 GGATTTCTATGTAACCAGAGTATCCTG 58.909 40.741 0.00 0.00 38.16 3.86
950 997 4.778534 ATGTCAAAAGCAGGTCTGATTG 57.221 40.909 2.07 4.29 39.36 2.67
979 1026 9.243105 GTGCATATGGTACCCAAATAAGAATAT 57.757 33.333 10.07 0.00 36.95 1.28
1126 1173 4.093011 GGTCATATAGGCCTGAGTCAGAT 58.907 47.826 22.09 9.32 39.61 2.90
1387 1434 0.476338 AGATAGAGGAGAGCGCCAGA 59.524 55.000 2.29 0.00 0.00 3.86
1634 1683 3.128349 GCGTAGTCACTTTTTCCTGTCA 58.872 45.455 0.00 0.00 0.00 3.58
1655 1704 3.104843 TCGCAAACAAAAAGGGGAATG 57.895 42.857 0.00 0.00 0.00 2.67
1865 1919 2.106684 ACTCTTGTGGTTTCCTCTTCCC 59.893 50.000 0.00 0.00 0.00 3.97
2115 2171 6.553100 CCTCTGTCTATTCTCTAATTCACCCT 59.447 42.308 0.00 0.00 0.00 4.34


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.