Multiple sequence alignment - TraesCS1D01G071500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G071500 chr1D 100.000 2255 0 0 1 2255 51916189 51918443 0.000000e+00 4165
1 TraesCS1D01G071500 chr6D 98.631 2045 25 2 212 2255 389255024 389252982 0.000000e+00 3618
2 TraesCS1D01G071500 chr6D 98.484 2045 28 2 212 2255 389250229 389248187 0.000000e+00 3602
3 TraesCS1D01G071500 chr6D 99.531 213 1 0 1 213 389250474 389250262 2.720000e-104 388
4 TraesCS1D01G071500 chr6D 99.061 213 2 0 1 213 389251019 389250807 1.260000e-102 383
5 TraesCS1D01G071500 chr6D 99.061 213 2 0 1 213 389255269 389255057 1.260000e-102 383
6 TraesCS1D01G071500 chr3A 98.484 2045 27 3 212 2255 66007277 66009318 0.000000e+00 3602
7 TraesCS1D01G071500 chr3A 99.531 213 1 0 1 213 593312788 593312576 2.720000e-104 388
8 TraesCS1D01G071500 chr3A 99.531 213 1 0 1 213 650016411 650016623 2.720000e-104 388
9 TraesCS1D01G071500 chr5D 98.435 2045 28 3 212 2255 503238881 503236840 0.000000e+00 3596
10 TraesCS1D01G071500 chr5D 98.386 2045 26 3 212 2255 503243127 503241089 0.000000e+00 3587
11 TraesCS1D01G071500 chr5D 98.337 2045 28 2 212 2255 503229100 503227061 0.000000e+00 3583
12 TraesCS1D01G071500 chr5D 98.289 2045 26 3 212 2255 503267447 503269483 0.000000e+00 3574
13 TraesCS1D01G071500 chr5D 99.061 213 2 0 1 213 503229345 503229133 1.260000e-102 383
14 TraesCS1D01G071500 chr5D 99.061 213 2 0 1 213 503239126 503238914 1.260000e-102 383
15 TraesCS1D01G071500 chr7B 98.386 2045 30 2 212 2255 662724259 662722217 0.000000e+00 3591
16 TraesCS1D01G071500 chr7B 99.531 213 1 0 1 213 663101325 663101537 2.720000e-104 388
17 TraesCS1D01G071500 chr3D 98.337 2045 30 3 212 2255 589265668 589267709 0.000000e+00 3585
18 TraesCS1D01G071500 chr2A 99.531 213 1 0 1 213 726899935 726899723 2.720000e-104 388


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G071500 chr1D 51916189 51918443 2254 False 4165.0 4165 100.000000 1 2255 1 chr1D.!!$F1 2254
1 TraesCS1D01G071500 chr6D 389248187 389255269 7082 True 1674.8 3618 98.953600 1 2255 5 chr6D.!!$R1 2254
2 TraesCS1D01G071500 chr3A 66007277 66009318 2041 False 3602.0 3602 98.484000 212 2255 1 chr3A.!!$F1 2043
3 TraesCS1D01G071500 chr5D 503267447 503269483 2036 False 3574.0 3574 98.289000 212 2255 1 chr5D.!!$F1 2043
4 TraesCS1D01G071500 chr5D 503236840 503243127 6287 True 2522.0 3596 98.627333 1 2255 3 chr5D.!!$R2 2254
5 TraesCS1D01G071500 chr5D 503227061 503229345 2284 True 1983.0 3583 98.699000 1 2255 2 chr5D.!!$R1 2254
6 TraesCS1D01G071500 chr7B 662722217 662724259 2042 True 3591.0 3591 98.386000 212 2255 1 chr7B.!!$R1 2043
7 TraesCS1D01G071500 chr3D 589265668 589267709 2041 False 3585.0 3585 98.337000 212 2255 1 chr3D.!!$F1 2043

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
353 4392 0.631212 CCCCAAGGGCAGGTTCTTAT 59.369 55.0 0.0 0.0 35.35 1.73 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1573 10407 0.667487 CGTGATGAACTGTCGGCACT 60.667 55.0 0.0 0.0 31.67 4.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
142 4144 0.883833 CATTGCTCCGTCAGGCTTTT 59.116 50.000 0.00 0.00 37.47 2.27
332 4371 1.411246 GTTTCCAGTTGTTGTTCCCCC 59.589 52.381 0.00 0.00 0.00 5.40
353 4392 0.631212 CCCCAAGGGCAGGTTCTTAT 59.369 55.000 0.00 0.00 35.35 1.73
361 4400 1.669265 GGCAGGTTCTTATGCGTTACC 59.331 52.381 0.00 0.00 43.49 2.85
383 4422 2.549282 CGTTCGCCACTGGAAACG 59.451 61.111 16.93 16.93 37.17 3.60
441 4480 0.674581 CAGCGTTCATCCTGAGCCAA 60.675 55.000 0.00 0.00 0.00 4.52
791 4830 5.986135 CGTCCCATCGAGAAAGAGAATTAAT 59.014 40.000 0.00 0.00 0.00 1.40
1641 10475 8.235905 GGATCGGTAACTAATAGTGCTACTAAG 58.764 40.741 0.00 0.00 33.89 2.18
1748 10582 7.427989 TCTGTATACTTTCCCCGTTCTATTT 57.572 36.000 4.17 0.00 0.00 1.40
1799 10633 7.013369 TCGGATCATATAGATATCCCTTCAACG 59.987 40.741 0.00 0.00 37.00 4.10
1843 10677 3.005554 CTCGAATGACTCACCAAAGCAT 58.994 45.455 0.00 0.00 0.00 3.79
1950 10784 4.801330 ATTCGGGATTTTTCTTGGGAAC 57.199 40.909 0.00 0.00 0.00 3.62
2115 10950 6.969993 AATAAGTCGAAGATAGAAGAGCCT 57.030 37.500 0.00 0.00 40.67 4.58
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
142 4144 0.248843 GGAATTTTCCGCAATGGGCA 59.751 50.000 0.00 0.00 45.17 5.36
268 4304 3.074390 TGAGGAGCAAAAGGAGAAATCCA 59.926 43.478 0.00 0.00 0.00 3.41
353 4392 2.030862 GAACGGGTGGGTAACGCA 59.969 61.111 0.00 0.00 41.73 5.24
383 4422 0.804989 CAAGTCGAATGGGAAGTGGC 59.195 55.000 0.00 0.00 0.00 5.01
441 4480 4.892345 TGAATCTCATGGAGAGTTCGATCT 59.108 41.667 0.00 0.00 42.26 2.75
482 4521 5.790593 TGCTTTGTCTACGAATAAGGAAGT 58.209 37.500 0.00 0.00 0.00 3.01
791 4830 1.341976 GCCCCTTTGCCTTAGGATTCA 60.342 52.381 0.69 0.00 34.56 2.57
1156 9990 6.269769 TGGAAATTGAAAAGAAATGTAGCCCT 59.730 34.615 0.00 0.00 0.00 5.19
1573 10407 0.667487 CGTGATGAACTGTCGGCACT 60.667 55.000 0.00 0.00 31.67 4.40
1748 10582 1.038681 TGCATAAGACCCGCGGTAGA 61.039 55.000 26.12 4.53 35.25 2.59
1799 10633 5.525378 AGATCTTTTCGATGACCTATGTTGC 59.475 40.000 0.00 0.00 30.84 4.17
1826 10660 4.560108 GCTTTCATGCTTTGGTGAGTCATT 60.560 41.667 0.00 0.00 0.00 2.57
1828 10662 2.294233 GCTTTCATGCTTTGGTGAGTCA 59.706 45.455 0.00 0.00 0.00 3.41
1843 10677 6.071391 GGAATCCATTTTCTAACTGGCTTTCA 60.071 38.462 0.00 0.00 0.00 2.69
1950 10784 4.462483 TCCATTCCAATTTCTTCCCGAAAG 59.538 41.667 0.00 0.00 44.29 2.62
2115 10950 9.312904 AGTTTCCATTTCTTCATTTGGAATCTA 57.687 29.630 10.77 0.00 45.14 1.98


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.