Multiple sequence alignment - TraesCS1D01G071300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G071300 chr1D 100.000 2579 0 0 1 2579 51880408 51882986 0.000000e+00 4763
1 TraesCS1D01G071300 chr1D 96.160 2604 63 20 1 2579 254403778 254401187 0.000000e+00 4220
2 TraesCS1D01G071300 chr5D 97.148 2595 56 14 1 2579 503284965 503282373 0.000000e+00 4366
3 TraesCS1D01G071300 chr5D 96.874 2591 65 10 1 2579 6183281 6185867 0.000000e+00 4322
4 TraesCS1D01G071300 chr5D 97.414 2436 46 11 160 2579 483806079 483808513 0.000000e+00 4133
5 TraesCS1D01G071300 chr6D 97.030 2593 61 13 1 2579 45513904 45516494 0.000000e+00 4348
6 TraesCS1D01G071300 chr2A 96.281 2608 66 20 1 2579 335832966 335835571 0.000000e+00 4250
7 TraesCS1D01G071300 chr2A 96.599 294 10 0 2104 2397 682726452 682726159 2.980000e-134 488
8 TraesCS1D01G071300 chr2A 87.245 196 18 7 2387 2578 712190247 712190439 1.550000e-52 217
9 TraesCS1D01G071300 chr4A 95.490 2594 92 16 1 2579 309509462 309512045 0.000000e+00 4119
10 TraesCS1D01G071300 chr4A 95.326 2589 100 16 1 2579 310732928 310735505 0.000000e+00 4091
11 TraesCS1D01G071300 chr3D 97.042 2096 39 10 497 2579 598875970 598873885 0.000000e+00 3506
12 TraesCS1D01G071300 chr5A 95.924 2110 61 16 37 2129 607202453 607204554 0.000000e+00 3397


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G071300 chr1D 51880408 51882986 2578 False 4763 4763 100.000 1 2579 1 chr1D.!!$F1 2578
1 TraesCS1D01G071300 chr1D 254401187 254403778 2591 True 4220 4220 96.160 1 2579 1 chr1D.!!$R1 2578
2 TraesCS1D01G071300 chr5D 503282373 503284965 2592 True 4366 4366 97.148 1 2579 1 chr5D.!!$R1 2578
3 TraesCS1D01G071300 chr5D 6183281 6185867 2586 False 4322 4322 96.874 1 2579 1 chr5D.!!$F1 2578
4 TraesCS1D01G071300 chr5D 483806079 483808513 2434 False 4133 4133 97.414 160 2579 1 chr5D.!!$F2 2419
5 TraesCS1D01G071300 chr6D 45513904 45516494 2590 False 4348 4348 97.030 1 2579 1 chr6D.!!$F1 2578
6 TraesCS1D01G071300 chr2A 335832966 335835571 2605 False 4250 4250 96.281 1 2579 1 chr2A.!!$F1 2578
7 TraesCS1D01G071300 chr4A 309509462 309512045 2583 False 4119 4119 95.490 1 2579 1 chr4A.!!$F1 2578
8 TraesCS1D01G071300 chr4A 310732928 310735505 2577 False 4091 4091 95.326 1 2579 1 chr4A.!!$F2 2578
9 TraesCS1D01G071300 chr3D 598873885 598875970 2085 True 3506 3506 97.042 497 2579 1 chr3D.!!$R1 2082
10 TraesCS1D01G071300 chr5A 607202453 607204554 2101 False 3397 3397 95.924 37 2129 1 chr5A.!!$F1 2092

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
585 614 2.495084 GGAATGATTCCCCGCTCTAAC 58.505 52.381 13.26 0.0 44.3 2.34 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2497 2560 3.308117 GGGTTGACCAGGTCATTGATACA 60.308 47.826 23.56 3.25 42.4 2.29 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
183 208 5.356882 TTGAGTGTTTTTCATGGTCGATC 57.643 39.130 0.00 0.00 0.00 3.69
222 248 7.275888 TGTCTTGCTAGTTCAATGTTTTGAT 57.724 32.000 0.00 0.00 41.38 2.57
402 430 4.080469 TGGTAGAGTCTAGAAGACCACGAT 60.080 45.833 7.52 0.00 46.18 3.73
585 614 2.495084 GGAATGATTCCCCGCTCTAAC 58.505 52.381 13.26 0.00 44.30 2.34
964 1001 9.521503 CTATGTATCATCATTCGATAAACCGAT 57.478 33.333 0.00 0.00 38.45 4.18
1124 1163 8.694540 CCATTATGGATTAAATGGTTCTGAACA 58.305 33.333 21.01 8.66 44.71 3.18
1367 1407 7.033185 CGGGAATTATTTTGTCCGAAAGAAAT 58.967 34.615 0.00 0.00 39.83 2.17
1537 1577 5.008019 CGTATCCAAGATGTTCCATCTTTGG 59.992 44.000 15.01 17.36 45.15 3.28
1602 1644 8.477419 AGTTTTAGTCCTTCAATGAAATCCAA 57.523 30.769 0.00 0.00 0.00 3.53
1734 1788 4.978099 AGCATCTTCTGGAACTTTTCTGA 58.022 39.130 0.00 0.00 0.00 3.27
1968 2029 4.213270 CAGCCGCGAAGAATCCATATAAAA 59.787 41.667 8.23 0.00 0.00 1.52
2107 2168 1.814429 ATTCGATACCATGGTCCCCA 58.186 50.000 23.76 3.54 38.19 4.96
2268 2330 9.481340 TTTCATTATCATAGTGGATCTTCGAAG 57.519 33.333 19.35 19.35 0.00 3.79
2293 2355 8.311836 AGAAATGGACTTTGTATCGACTAAAGA 58.688 33.333 18.93 3.73 35.82 2.52
2321 2383 5.297547 ACTTCGACTTTCATGTGCTAGAAA 58.702 37.500 0.00 0.00 33.17 2.52
2410 2473 8.060931 AGAAGAATTTTTATGGAAGAAGAGCC 57.939 34.615 0.00 0.00 0.00 4.70
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
222 248 0.458889 AATTACACCGCGCGCTTCTA 60.459 50.000 30.48 9.58 0.00 2.10
359 386 9.529823 TCTACCAAGAGTCTAGAGAATTTGTTA 57.470 33.333 0.00 0.00 0.00 2.41
585 614 8.477709 CGGCACTAATCTATTTTTAACGTCTAG 58.522 37.037 0.00 0.00 0.00 2.43
964 1001 7.619050 ACTTGATCAGAGAGAAGAAGCATTTA 58.381 34.615 10.61 0.00 0.00 1.40
1293 1333 5.607939 TCGCAAACCCTTCAGATAGAATA 57.392 39.130 0.00 0.00 35.25 1.75
1456 1496 9.805204 ATGGATAGGACAGGGTATTTCTATATT 57.195 33.333 0.00 0.00 0.00 1.28
1472 1512 4.829492 CCAGGATTTCCAAATGGATAGGAC 59.171 45.833 2.38 0.00 44.98 3.85
1584 1626 8.606040 TGAAAAATTGGATTTCATTGAAGGAC 57.394 30.769 0.00 0.00 40.75 3.85
1734 1788 8.964772 CATCTTCCTAGAAAAGTGGATTCATTT 58.035 33.333 0.00 0.00 33.20 2.32
2100 2161 6.828270 CCTATGAGGAGAGTAGTGGGGACC 62.828 58.333 0.00 0.00 45.08 4.46
2268 2330 8.475331 TCTTTAGTCGATACAAAGTCCATTTC 57.525 34.615 12.96 0.00 32.36 2.17
2293 2355 8.414003 TCTAGCACATGAAAGTCGAAGTATATT 58.586 33.333 0.00 0.00 0.00 1.28
2321 2383 6.959311 CGTGCTTTTATGTTTACGAGCTAAAT 59.041 34.615 0.00 0.00 33.78 1.40
2497 2560 3.308117 GGGTTGACCAGGTCATTGATACA 60.308 47.826 23.56 3.25 42.40 2.29


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.