Multiple sequence alignment - TraesCS1D01G071200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G071200 chr1D 100.000 2195 0 0 1 2195 51878923 51876729 0 4054
1 TraesCS1D01G071200 chr1D 97.001 2201 47 8 1 2195 254416213 254418400 0 3681
2 TraesCS1D01G071200 chr1D 95.174 2155 96 6 1 2152 260891256 260893405 0 3397
3 TraesCS1D01G071200 chr5D 97.327 2207 44 11 1 2195 503286449 503288652 0 3735
4 TraesCS1D01G071200 chr5D 97.047 2201 52 11 1 2195 120799019 120801212 0 3692
5 TraesCS1D01G071200 chr5D 96.960 2204 42 17 1 2195 6181795 6179608 0 3675
6 TraesCS1D01G071200 chr5D 95.955 2200 75 12 1 2195 167071082 167073272 0 3557
7 TraesCS1D01G071200 chr5D 97.818 1100 17 6 1102 2195 512409297 512408199 0 1892
8 TraesCS1D01G071200 chr6D 97.184 2202 41 15 1 2195 45512415 45510228 0 3703
9 TraesCS1D01G071200 chr4A 95.657 1750 61 11 1 1746 310731445 310729707 0 2796
10 TraesCS1D01G071200 chr2A 97.384 1644 35 6 1 1641 335831479 335829841 0 2791
11 TraesCS1D01G071200 chr2A 96.796 1186 25 4 1012 2194 334595896 334594721 0 1967


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G071200 chr1D 51876729 51878923 2194 True 4054 4054 100.000 1 2195 1 chr1D.!!$R1 2194
1 TraesCS1D01G071200 chr1D 254416213 254418400 2187 False 3681 3681 97.001 1 2195 1 chr1D.!!$F1 2194
2 TraesCS1D01G071200 chr1D 260891256 260893405 2149 False 3397 3397 95.174 1 2152 1 chr1D.!!$F2 2151
3 TraesCS1D01G071200 chr5D 503286449 503288652 2203 False 3735 3735 97.327 1 2195 1 chr5D.!!$F3 2194
4 TraesCS1D01G071200 chr5D 120799019 120801212 2193 False 3692 3692 97.047 1 2195 1 chr5D.!!$F1 2194
5 TraesCS1D01G071200 chr5D 6179608 6181795 2187 True 3675 3675 96.960 1 2195 1 chr5D.!!$R1 2194
6 TraesCS1D01G071200 chr5D 167071082 167073272 2190 False 3557 3557 95.955 1 2195 1 chr5D.!!$F2 2194
7 TraesCS1D01G071200 chr5D 512408199 512409297 1098 True 1892 1892 97.818 1102 2195 1 chr5D.!!$R2 1093
8 TraesCS1D01G071200 chr6D 45510228 45512415 2187 True 3703 3703 97.184 1 2195 1 chr6D.!!$R1 2194
9 TraesCS1D01G071200 chr4A 310729707 310731445 1738 True 2796 2796 95.657 1 1746 1 chr4A.!!$R1 1745
10 TraesCS1D01G071200 chr2A 335829841 335831479 1638 True 2791 2791 97.384 1 1641 1 chr2A.!!$R2 1640
11 TraesCS1D01G071200 chr2A 334594721 334595896 1175 True 1967 1967 96.796 1012 2194 1 chr2A.!!$R1 1182

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
658 664 1.228429 GCCTTACCACTTGGCCACA 60.228 57.895 3.88 0.0 40.71 4.17 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1895 1917 1.808411 TCGCTTTGGAACATGGAGAC 58.192 50.0 0.0 0.0 39.3 3.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
181 182 5.928839 TGAGAAAAGAAGGATTGACTCTTCG 59.071 40.000 0.00 0.00 42.85 3.79
636 642 1.270465 CGAGTAACGGGACCAAAACCT 60.270 52.381 0.00 0.00 38.46 3.50
658 664 1.228429 GCCTTACCACTTGGCCACA 60.228 57.895 3.88 0.00 40.71 4.17
868 875 8.567285 AGTCGAATTTATTCCACTCTCATTTT 57.433 30.769 0.00 0.00 33.88 1.82
1138 1147 8.820933 CAATCGTGGATATTATGCCTGTTATAG 58.179 37.037 0.00 0.00 0.00 1.31
1345 1359 4.844349 ACATTGAATGGGTAGCTACAGT 57.156 40.909 24.75 5.08 33.60 3.55
1376 1390 2.119495 GATCAGCCTTTCTACTCCCCA 58.881 52.381 0.00 0.00 0.00 4.96
1841 1863 1.143401 GGGATTCGAACCCTCGGTC 59.857 63.158 21.61 6.39 45.49 4.79
1895 1917 2.012673 GCTTTAGTCCACTCAGCCATG 58.987 52.381 0.94 0.00 0.00 3.66
1928 1950 3.390003 AGCGAAAGGTTTCCGTGAA 57.610 47.368 0.00 0.00 40.01 3.18
2145 2171 7.615403 TCTCTTTAGCGAGCATTTCCATATAT 58.385 34.615 0.00 0.00 0.00 0.86
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
56 57 4.971220 GTCGCCTTTTTCAAACGATGTTTA 59.029 37.500 0.00 0.00 34.96 2.01
75 76 6.624542 GTTTTAAGCAAACTTGTTTAGTCGC 58.375 36.000 0.00 0.00 41.58 5.19
536 542 9.622004 CATATAGTATTCCGTACGAGACAAAAT 57.378 33.333 18.76 8.64 38.38 1.82
868 875 3.362706 ACCTCCTTGTATTCGCACTCTA 58.637 45.455 0.00 0.00 0.00 2.43
932 939 1.911057 AGGGAAAGAAGGAAAAGGCG 58.089 50.000 0.00 0.00 0.00 5.52
1210 1220 7.036829 TGAACACATCATTCAATTTGGCATAG 58.963 34.615 0.00 0.00 33.16 2.23
1345 1359 9.920946 AGTAGAAAGGCTGATCCAAATTTATTA 57.079 29.630 0.00 0.00 37.29 0.98
1376 1390 0.838122 ACCTGCTCAACCTAGGTGCT 60.838 55.000 17.14 0.00 42.95 4.40
1739 1761 9.489084 CCGGATTTTCTCATAGATAAATGTACA 57.511 33.333 0.00 0.00 0.00 2.90
1895 1917 1.808411 TCGCTTTGGAACATGGAGAC 58.192 50.000 0.00 0.00 39.30 3.36


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.