Multiple sequence alignment - TraesCS1D01G071100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G071100 chr1D 100.000 2111 0 0 1 2111 51878327 51876217 0.000000e+00 3899
1 TraesCS1D01G071100 chr1D 95.311 1557 68 4 1 1556 260891853 260893405 0.000000e+00 2466
2 TraesCS1D01G071100 chr5D 97.363 2124 41 11 1 2111 503287046 503289167 0.000000e+00 3598
3 TraesCS1D01G071100 chr5D 96.887 2120 43 15 1 2111 6181200 6179095 0.000000e+00 3528
4 TraesCS1D01G071100 chr5D 96.834 2116 48 12 1 2111 120799618 120801719 0.000000e+00 3518
5 TraesCS1D01G071100 chr5D 95.839 2115 68 16 1 2111 167071680 167073778 0.000000e+00 3400
6 TraesCS1D01G071100 chr5D 97.650 1532 25 9 506 2028 512409297 512407768 0.000000e+00 2619
7 TraesCS1D01G071100 chr5D 97.583 1448 23 8 506 1942 512416234 512414788 0.000000e+00 2470
8 TraesCS1D01G071100 chr5D 93.861 1010 35 6 1 1009 513639952 513638969 0.000000e+00 1496
9 TraesCS1D01G071100 chr6D 97.262 2118 42 12 1 2111 45511825 45509717 0.000000e+00 3576
10 TraesCS1D01G071100 chr1A 96.615 2127 40 19 1 2111 554458213 554460323 0.000000e+00 3500
11 TraesCS1D01G071100 chr4A 95.403 2110 75 10 4 2111 309507385 309505296 0.000000e+00 3339
12 TraesCS1D01G071100 chr2D 97.202 1966 32 11 155 2111 9785044 9786995 0.000000e+00 3304
13 TraesCS1D01G071100 chr2B 96.429 252 6 2 1860 2111 740132057 740132305 1.510000e-111 412
14 TraesCS1D01G071100 chr3B 95.652 161 7 0 1950 2110 764872526 764872366 2.080000e-65 259
15 TraesCS1D01G071100 chr3B 98.795 83 1 0 2029 2111 786791345 786791427 4.690000e-32 148
16 TraesCS1D01G071100 chr3A 95.092 163 5 2 1952 2111 593319680 593319842 9.670000e-64 254


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G071100 chr1D 51876217 51878327 2110 True 3899 3899 100.000 1 2111 1 chr1D.!!$R1 2110
1 TraesCS1D01G071100 chr1D 260891853 260893405 1552 False 2466 2466 95.311 1 1556 1 chr1D.!!$F1 1555
2 TraesCS1D01G071100 chr5D 503287046 503289167 2121 False 3598 3598 97.363 1 2111 1 chr5D.!!$F3 2110
3 TraesCS1D01G071100 chr5D 6179095 6181200 2105 True 3528 3528 96.887 1 2111 1 chr5D.!!$R1 2110
4 TraesCS1D01G071100 chr5D 120799618 120801719 2101 False 3518 3518 96.834 1 2111 1 chr5D.!!$F1 2110
5 TraesCS1D01G071100 chr5D 167071680 167073778 2098 False 3400 3400 95.839 1 2111 1 chr5D.!!$F2 2110
6 TraesCS1D01G071100 chr5D 512407768 512409297 1529 True 2619 2619 97.650 506 2028 1 chr5D.!!$R2 1522
7 TraesCS1D01G071100 chr5D 512414788 512416234 1446 True 2470 2470 97.583 506 1942 1 chr5D.!!$R3 1436
8 TraesCS1D01G071100 chr5D 513638969 513639952 983 True 1496 1496 93.861 1 1009 1 chr5D.!!$R4 1008
9 TraesCS1D01G071100 chr6D 45509717 45511825 2108 True 3576 3576 97.262 1 2111 1 chr6D.!!$R1 2110
10 TraesCS1D01G071100 chr1A 554458213 554460323 2110 False 3500 3500 96.615 1 2111 1 chr1A.!!$F1 2110
11 TraesCS1D01G071100 chr4A 309505296 309507385 2089 True 3339 3339 95.403 4 2111 1 chr4A.!!$R1 2107
12 TraesCS1D01G071100 chr2D 9785044 9786995 1951 False 3304 3304 97.202 155 2111 1 chr2D.!!$F1 1956

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
780 788 2.119495 GATCAGCCTTTCTACTCCCCA 58.881 52.381 0.0 0.0 0.0 4.96 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1638 1668 7.972301 TCTTTCCAATTTTATGGTGGATTTGT 58.028 30.769 0.0 0.0 41.05 2.83 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
272 274 8.567285 AGTCGAATTTATTCCACTCTCATTTT 57.433 30.769 0.00 0.00 33.88 1.82
542 547 8.820933 CAATCGTGGATATTATGCCTGTTATAG 58.179 37.037 0.00 0.00 0.00 1.31
749 757 4.844349 ACATTGAATGGGTAGCTACAGT 57.156 40.909 24.75 5.08 33.60 3.55
780 788 2.119495 GATCAGCCTTTCTACTCCCCA 58.881 52.381 0.00 0.00 0.00 4.96
1119 1135 3.921677 ACGCGAGGAGTAAAAATTCAGA 58.078 40.909 15.93 0.00 0.00 3.27
1245 1264 1.143401 GGGATTCGAACCCTCGGTC 59.857 63.158 21.61 6.39 45.49 4.79
1299 1319 2.012673 GCTTTAGTCCACTCAGCCATG 58.987 52.381 0.94 0.00 0.00 3.66
1332 1352 3.390003 AGCGAAAGGTTTCCGTGAA 57.610 47.368 0.00 0.00 40.01 3.18
1549 1573 7.615403 TCTCTTTAGCGAGCATTTCCATATAT 58.385 34.615 0.00 0.00 0.00 0.86
1638 1668 7.176589 TCAAGAAAGCAAAAAGGGTTCTTAA 57.823 32.000 0.00 0.00 32.01 1.85
1709 1739 5.608437 ACTCCTTTAATGATGCCTCTATCCA 59.392 40.000 0.00 0.00 0.00 3.41
1888 1921 3.773860 TGCGCTACACATAAAATTGGG 57.226 42.857 9.73 0.00 0.00 4.12
1958 1997 3.464833 ACCCATGCAATAGAGAGGGAATT 59.535 43.478 0.00 0.00 39.60 2.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
19 20 1.270252 GGTTTTGGTCCCGTTACTCGA 60.270 52.381 0.00 0.0 42.86 4.04
272 274 3.362706 ACCTCCTTGTATTCGCACTCTA 58.637 45.455 0.00 0.0 0.00 2.43
336 338 1.911057 AGGGAAAGAAGGAAAAGGCG 58.089 50.000 0.00 0.0 0.00 5.52
614 620 7.036829 TGAACACATCATTCAATTTGGCATAG 58.963 34.615 0.00 0.0 33.16 2.23
654 661 5.771165 ACTTCTCGGCTTTTACCCATTTTTA 59.229 36.000 0.00 0.0 0.00 1.52
655 662 4.587262 ACTTCTCGGCTTTTACCCATTTTT 59.413 37.500 0.00 0.0 0.00 1.94
749 757 9.920946 AGTAGAAAGGCTGATCCAAATTTATTA 57.079 29.630 0.00 0.0 37.29 0.98
780 788 0.838122 ACCTGCTCAACCTAGGTGCT 60.838 55.000 17.14 0.0 42.95 4.40
1143 1162 9.489084 CCGGATTTTCTCATAGATAAATGTACA 57.511 33.333 0.00 0.0 0.00 2.90
1299 1319 1.808411 TCGCTTTGGAACATGGAGAC 58.192 50.000 0.00 0.0 39.30 3.36
1638 1668 7.972301 TCTTTCCAATTTTATGGTGGATTTGT 58.028 30.769 0.00 0.0 41.05 2.83
1729 1759 9.710900 ATCGCTTATACAATTTCATCTACATCA 57.289 29.630 0.00 0.0 0.00 3.07


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.