Multiple sequence alignment - TraesCS1D01G071000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G071000 chr1D 100.000 2213 0 0 1 2213 51871929 51869717 0.000000e+00 4087.0
1 TraesCS1D01G071000 chr1D 96.716 2223 60 6 1 2213 254435042 254437261 0.000000e+00 3688.0
2 TraesCS1D01G071000 chr2D 97.121 2223 51 8 1 2213 638424513 638426732 0.000000e+00 3738.0
3 TraesCS1D01G071000 chr2D 98.857 175 1 1 244 418 112182002 112182175 5.930000e-81 311.0
4 TraesCS1D01G071000 chr2D 100.000 28 0 0 157 184 383359889 383359916 4.000000e-03 52.8
5 TraesCS1D01G071000 chr5D 96.897 2224 57 7 1 2213 503291879 503294101 0.000000e+00 3714.0
6 TraesCS1D01G071000 chr5D 96.311 2223 54 10 1 2213 6176908 6174704 0.000000e+00 3626.0
7 TraesCS1D01G071000 chr5D 97.403 1887 37 7 1 1876 512410193 512412078 0.000000e+00 3203.0
8 TraesCS1D01G071000 chr5D 97.350 1887 37 8 1 1876 512417130 512419014 0.000000e+00 3195.0
9 TraesCS1D01G071000 chr5D 92.843 489 33 2 1725 2213 12935856 12936342 0.000000e+00 708.0
10 TraesCS1D01G071000 chr4B 95.418 2226 87 10 1 2213 308679760 308677537 0.000000e+00 3531.0
11 TraesCS1D01G071000 chr4D 93.348 2225 122 16 2 2213 207068216 207066005 0.000000e+00 3265.0
12 TraesCS1D01G071000 chr1B 96.239 1888 59 7 336 2213 633708037 633709922 0.000000e+00 3083.0
13 TraesCS1D01G071000 chr2B 98.191 387 7 0 61 447 90714308 90713922 0.000000e+00 676.0
14 TraesCS1D01G071000 chr3B 98.406 251 4 0 180 430 460131979 460132229 2.020000e-120 442.0
15 TraesCS1D01G071000 chr3A 96.410 195 7 0 136 330 614191799 614191605 2.740000e-84 322.0
16 TraesCS1D01G071000 chr3A 97.987 149 3 0 1 149 418377305 418377157 2.180000e-65 259.0
17 TraesCS1D01G071000 chr5A 92.857 210 13 2 132 340 630345778 630345986 9.930000e-79 303.0
18 TraesCS1D01G071000 chr5A 93.939 99 6 0 35 133 630347023 630346925 1.370000e-32 150.0
19 TraesCS1D01G071000 chr4A 100.000 30 0 0 1 30 687544171 687544200 3.070000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G071000 chr1D 51869717 51871929 2212 True 4087 4087 100.000 1 2213 1 chr1D.!!$R1 2212
1 TraesCS1D01G071000 chr1D 254435042 254437261 2219 False 3688 3688 96.716 1 2213 1 chr1D.!!$F1 2212
2 TraesCS1D01G071000 chr2D 638424513 638426732 2219 False 3738 3738 97.121 1 2213 1 chr2D.!!$F3 2212
3 TraesCS1D01G071000 chr5D 503291879 503294101 2222 False 3714 3714 96.897 1 2213 1 chr5D.!!$F2 2212
4 TraesCS1D01G071000 chr5D 6174704 6176908 2204 True 3626 3626 96.311 1 2213 1 chr5D.!!$R1 2212
5 TraesCS1D01G071000 chr5D 512410193 512412078 1885 False 3203 3203 97.403 1 1876 1 chr5D.!!$F3 1875
6 TraesCS1D01G071000 chr5D 512417130 512419014 1884 False 3195 3195 97.350 1 1876 1 chr5D.!!$F4 1875
7 TraesCS1D01G071000 chr4B 308677537 308679760 2223 True 3531 3531 95.418 1 2213 1 chr4B.!!$R1 2212
8 TraesCS1D01G071000 chr4D 207066005 207068216 2211 True 3265 3265 93.348 2 2213 1 chr4D.!!$R1 2211
9 TraesCS1D01G071000 chr1B 633708037 633709922 1885 False 3083 3083 96.239 336 2213 1 chr1B.!!$F1 1877

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
513 517 0.681733 TTCCATCTAGCCGAGCCATC 59.318 55.0 0.0 0.0 0.0 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1421 1443 0.032952 TCTGGGTCGACCGTTTCAAG 59.967 55.0 27.68 16.7 44.64 3.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
103 104 3.004944 GGAAACTATGCGTTTTTGGGACA 59.995 43.478 0.00 0.00 45.48 4.02
193 194 1.981256 ACAACCTTGGCAAGAACGAT 58.019 45.000 28.18 6.96 0.00 3.73
212 213 5.787380 ACGATGCTCAGCAGAATATATGAA 58.213 37.500 5.13 0.00 43.65 2.57
513 517 0.681733 TTCCATCTAGCCGAGCCATC 59.318 55.000 0.00 0.00 0.00 3.51
630 637 7.232127 CCCTCGATAGTTCCTAAAACTATACCA 59.768 40.741 9.72 0.00 41.91 3.25
647 654 8.253754 ACTATACCAGTTTTCAAGACCGGAGG 62.254 46.154 9.46 0.00 46.49 4.30
944 959 7.404980 TGATTAAACCCCTCCTACTTCTTGTAT 59.595 37.037 0.00 0.00 0.00 2.29
945 960 7.578458 TTAAACCCCTCCTACTTCTTGTATT 57.422 36.000 0.00 0.00 0.00 1.89
1021 1037 4.345257 TGATGGTAGCTTGGAGGATTAGAC 59.655 45.833 0.00 0.00 0.00 2.59
1095 1111 7.281774 TCCTCAGTCTTAGTAATTAGTGTACCG 59.718 40.741 2.90 0.00 0.00 4.02
1177 1193 7.379059 ACATCATTATGGATTGGACTAGTCA 57.621 36.000 23.91 5.26 37.43 3.41
1340 1358 4.633565 CCGAATTGCTAGCTCTTCTCTTTT 59.366 41.667 17.23 0.00 0.00 2.27
1341 1359 5.447010 CCGAATTGCTAGCTCTTCTCTTTTG 60.447 44.000 17.23 5.09 0.00 2.44
1362 1380 9.248291 CTTTTGGTATTATGAAATTCCATTCCG 57.752 33.333 0.00 0.00 40.84 4.30
1696 1719 0.972471 CCCTTCCTTTGCATCCCACC 60.972 60.000 0.00 0.00 0.00 4.61
1697 1720 0.040204 CCTTCCTTTGCATCCCACCT 59.960 55.000 0.00 0.00 0.00 4.00
1752 1776 0.603707 TCGCCAACAGAGCTCCAAAG 60.604 55.000 10.93 0.49 0.00 2.77
1876 1903 0.315251 AGCCTTGCGCCTTCTTTTTC 59.685 50.000 4.18 0.00 38.78 2.29
1901 1928 1.065551 GGCAAGTGACTTCGCAAACTT 59.934 47.619 17.11 0.00 33.20 2.66
1942 1970 4.587262 GGGCCGGGAACTAATGAATAAAAT 59.413 41.667 2.18 0.00 0.00 1.82
1947 1975 7.228590 CCGGGAACTAATGAATAAAATAGGGA 58.771 38.462 0.00 0.00 0.00 4.20
2084 2127 2.421751 AACTGCTCTACTCCGCTCTA 57.578 50.000 0.00 0.00 0.00 2.43
2149 2192 8.256356 AGCCTCTAACATGTCTAGACAAATAT 57.744 34.615 28.43 16.89 45.41 1.28
2200 2243 4.235731 GGGAATCGAACCCGCATT 57.764 55.556 13.87 0.00 37.85 3.56
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
103 104 3.270877 GTTCTAACCATGGAGCACGAAT 58.729 45.455 21.47 0.00 0.00 3.34
193 194 5.059161 GTGGTTCATATATTCTGCTGAGCA 58.941 41.667 7.05 7.05 36.92 4.26
212 213 0.905337 AGAGCCTAAAGGAGCGTGGT 60.905 55.000 0.00 0.00 37.39 4.16
567 574 8.321353 TCTCTCTCCTTTTGCTTATTGAATACA 58.679 33.333 0.00 0.00 0.00 2.29
630 637 3.581332 TGATACCTCCGGTCTTGAAAACT 59.419 43.478 0.00 0.00 37.09 2.66
647 654 3.133721 AGAGATGGCTGAGTGGTTGATAC 59.866 47.826 0.00 0.00 0.00 2.24
1021 1037 8.790718 AGCTAATTGGAAAGCAATAGTCATATG 58.209 33.333 0.00 0.00 41.32 1.78
1095 1111 4.201990 CCATCAGGAGAAGCAAATACAAGC 60.202 45.833 0.00 0.00 36.89 4.01
1177 1193 8.177119 AGAGAATTCAGAATAGCTACGAGAAT 57.823 34.615 8.44 1.29 0.00 2.40
1314 1332 4.100808 AGAGAAGAGCTAGCAATTCGGAAT 59.899 41.667 18.83 4.49 0.00 3.01
1340 1358 8.704849 AATCGGAATGGAATTTCATAATACCA 57.295 30.769 0.00 0.00 36.07 3.25
1421 1443 0.032952 TCTGGGTCGACCGTTTCAAG 59.967 55.000 27.68 16.70 44.64 3.02
1422 1444 0.249573 GTCTGGGTCGACCGTTTCAA 60.250 55.000 27.68 7.51 44.64 2.69
1485 1507 3.000041 CCATTGAACTACGCTTGCTACA 59.000 45.455 0.00 0.00 0.00 2.74
1491 1513 8.732746 AGATATTTTACCATTGAACTACGCTT 57.267 30.769 0.00 0.00 0.00 4.68
1637 1660 4.142227 ACGGCACTAGACTAACACCTAATG 60.142 45.833 0.00 0.00 0.00 1.90
1752 1776 7.681939 TGTTTGTCTCAGTTAATACCCAATC 57.318 36.000 0.00 0.00 0.00 2.67
1876 1903 0.514691 GCGAAGTCACTTGCCTTCAG 59.485 55.000 0.00 0.00 37.52 3.02
1955 1983 9.983024 CTATTTCTCTAGATATGGTAGAGGGAA 57.017 37.037 14.65 11.51 42.63 3.97
1956 1984 9.352839 TCTATTTCTCTAGATATGGTAGAGGGA 57.647 37.037 14.65 7.57 42.63 4.20
2149 2192 9.998106 GCTCCATTCTGTATAAAAGGAGTATTA 57.002 33.333 0.00 0.00 42.36 0.98


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.