Multiple sequence alignment - TraesCS1D01G070900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G070900 chr1D 100.000 2132 0 0 1 2132 51868492 51866361 0.000000e+00 3938.0
1 TraesCS1D01G070900 chr1D 96.224 2145 43 19 1 2132 254438485 254440604 0.000000e+00 3478.0
2 TraesCS1D01G070900 chr1D 94.988 1237 31 10 203 1408 491425284 491424048 0.000000e+00 1912.0
3 TraesCS1D01G070900 chr1D 97.327 1085 16 7 908 1981 491424059 491422977 0.000000e+00 1831.0
4 TraesCS1D01G070900 chr1D 95.514 691 18 8 530 1209 459909454 459908766 0.000000e+00 1092.0
5 TraesCS1D01G070900 chr5D 96.930 2150 43 15 1 2132 503295324 503297468 0.000000e+00 3583.0
6 TraesCS1D01G070900 chr5D 96.737 2145 50 13 1 2132 6173483 6171346 0.000000e+00 3555.0
7 TraesCS1D01G070900 chr5D 97.396 1997 33 12 1 1981 512412694 512414687 0.000000e+00 3382.0
8 TraesCS1D01G070900 chr5D 96.710 1945 46 12 202 2132 6272353 6270413 0.000000e+00 3221.0
9 TraesCS1D01G070900 chr4D 95.112 2148 60 15 1 2132 19871955 19874073 0.000000e+00 3343.0
10 TraesCS1D01G070900 chr4B 94.587 2143 73 13 1 2132 308676316 308674206 0.000000e+00 3275.0
11 TraesCS1D01G070900 chr4A 94.020 1739 72 12 1 1726 309486370 309484651 0.000000e+00 2606.0
12 TraesCS1D01G070900 chr6B 94.404 1251 38 8 313 1536 450072022 450073267 0.000000e+00 1893.0
13 TraesCS1D01G070900 chr6B 96.615 325 10 1 35 358 672998050 672997726 2.410000e-149 538.0
14 TraesCS1D01G070900 chr6B 93.088 217 11 4 1920 2132 70877130 70876914 4.420000e-82 315.0
15 TraesCS1D01G070900 chr2D 97.043 947 19 3 1186 2132 638429056 638429993 0.000000e+00 1585.0
16 TraesCS1D01G070900 chr2D 100.000 34 0 0 1 34 628293376 628293343 1.770000e-06 63.9
17 TraesCS1D01G070900 chr3D 91.453 351 17 4 1792 2132 235644625 235644972 8.910000e-129 470.0
18 TraesCS1D01G070900 chr5A 97.863 234 3 2 2 233 267849004 267848771 9.160000e-109 403.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G070900 chr1D 51866361 51868492 2131 True 3938.0 3938 100.0000 1 2132 1 chr1D.!!$R1 2131
1 TraesCS1D01G070900 chr1D 254438485 254440604 2119 False 3478.0 3478 96.2240 1 2132 1 chr1D.!!$F1 2131
2 TraesCS1D01G070900 chr1D 491422977 491425284 2307 True 1871.5 1912 96.1575 203 1981 2 chr1D.!!$R3 1778
3 TraesCS1D01G070900 chr1D 459908766 459909454 688 True 1092.0 1092 95.5140 530 1209 1 chr1D.!!$R2 679
4 TraesCS1D01G070900 chr5D 503295324 503297468 2144 False 3583.0 3583 96.9300 1 2132 1 chr5D.!!$F1 2131
5 TraesCS1D01G070900 chr5D 6171346 6173483 2137 True 3555.0 3555 96.7370 1 2132 1 chr5D.!!$R1 2131
6 TraesCS1D01G070900 chr5D 512412694 512414687 1993 False 3382.0 3382 97.3960 1 1981 1 chr5D.!!$F2 1980
7 TraesCS1D01G070900 chr5D 6270413 6272353 1940 True 3221.0 3221 96.7100 202 2132 1 chr5D.!!$R2 1930
8 TraesCS1D01G070900 chr4D 19871955 19874073 2118 False 3343.0 3343 95.1120 1 2132 1 chr4D.!!$F1 2131
9 TraesCS1D01G070900 chr4B 308674206 308676316 2110 True 3275.0 3275 94.5870 1 2132 1 chr4B.!!$R1 2131
10 TraesCS1D01G070900 chr4A 309484651 309486370 1719 True 2606.0 2606 94.0200 1 1726 1 chr4A.!!$R1 1725
11 TraesCS1D01G070900 chr6B 450072022 450073267 1245 False 1893.0 1893 94.4040 313 1536 1 chr6B.!!$F1 1223
12 TraesCS1D01G070900 chr2D 638429056 638429993 937 False 1585.0 1585 97.0430 1186 2132 1 chr2D.!!$F1 946

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
240 242 1.410004 TAGAGGTCCAGGCCATTACG 58.59 55.0 5.01 0.0 0.0 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1236 1774 1.298667 GGTTTGGGCCGAGCTAGAA 59.701 57.895 7.62 0.0 0.0 2.1 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
240 242 1.410004 TAGAGGTCCAGGCCATTACG 58.590 55.000 5.01 0.00 0.00 3.18
248 250 3.254903 GTCCAGGCCATTACGAAAAGTTT 59.745 43.478 5.01 0.00 0.00 2.66
641 651 4.347000 GGTAGAGTAATGCCATGGTAAGGA 59.653 45.833 14.67 0.00 0.00 3.36
729 739 3.348795 CGTAAGTCGTTGGTTCGAATG 57.651 47.619 0.00 0.00 41.47 2.67
840 854 3.960102 GGGATGGATGCATTTTTGGTCTA 59.040 43.478 0.00 0.00 0.00 2.59
859 873 5.178809 GGTCTAAACACTAAATGAAGCACGT 59.821 40.000 0.00 0.00 0.00 4.49
925 942 8.962884 AAAGCATAACAGAAAAGTTGGAAAAT 57.037 26.923 0.00 0.00 33.07 1.82
1125 1663 4.912133 GGGGTAGGGAGTATTATGAAAGGT 59.088 45.833 0.00 0.00 0.00 3.50
1155 1693 8.697507 AATCATAGATTAGCAAAAACCCTAGG 57.302 34.615 0.06 0.06 0.00 3.02
1236 1774 5.060506 TGACAATGTCTACGTTGGTTCAAT 58.939 37.500 14.97 0.00 44.80 2.57
1400 1958 7.875041 TCTCTCTCATTCCTTTCTTACAAACAG 59.125 37.037 0.00 0.00 0.00 3.16
1499 2057 7.174426 TCACTCTCACTATACCCACGTATAATG 59.826 40.741 0.00 0.00 37.06 1.90
1574 2132 7.713750 AGACGAATCGAATCTTCTTATGGTTA 58.286 34.615 10.55 0.00 0.00 2.85
1829 2388 2.184565 AGGGAGGGAAGGCATATAGGAA 59.815 50.000 0.00 0.00 0.00 3.36
1830 2389 3.181379 AGGGAGGGAAGGCATATAGGAAT 60.181 47.826 0.00 0.00 0.00 3.01
1865 2426 8.080417 CACTACTCCCGATCGATAAAGATAAAA 58.920 37.037 18.66 0.00 0.00 1.52
2084 2645 7.285566 ACTGCTTATTTGGATGTCTATGTGAT 58.714 34.615 0.00 0.00 0.00 3.06
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
229 231 4.379499 GGAGAAACTTTTCGTAATGGCCTG 60.379 45.833 3.32 0.00 41.92 4.85
240 242 4.667573 AGGATCCTTGGGAGAAACTTTTC 58.332 43.478 9.02 0.00 34.05 2.29
248 250 6.952430 ATAGGATATAGGATCCTTGGGAGA 57.048 41.667 22.03 0.00 45.78 3.71
391 393 5.221244 CCAACTCTTCTTGGTTTAGGGTTTG 60.221 44.000 0.00 0.00 36.65 2.93
399 401 8.960591 CATAACATATCCAACTCTTCTTGGTTT 58.039 33.333 0.00 0.00 41.49 3.27
641 651 9.613428 TTATCAGATTTGAACCGATGACTTATT 57.387 29.630 0.00 0.00 36.78 1.40
815 829 1.137479 CAAAAATGCATCCATCCCGCT 59.863 47.619 0.00 0.00 0.00 5.52
840 854 6.854496 TTCTACGTGCTTCATTTAGTGTTT 57.146 33.333 0.00 0.00 0.00 2.83
903 919 8.084684 AGAGATTTTCCAACTTTTCTGTTATGC 58.915 33.333 0.00 0.00 0.00 3.14
1001 1539 0.107831 GGGCCATATACAACCGCTCA 59.892 55.000 4.39 0.00 0.00 4.26
1125 1663 8.691797 GGGTTTTTGCTAATCTATGATTAACCA 58.308 33.333 15.93 8.39 0.00 3.67
1155 1693 4.214332 GCATCGACCCAGGAAGAATTTATC 59.786 45.833 0.00 0.00 0.00 1.75
1227 1765 2.356135 GCCGAGCTAGAATTGAACCAA 58.644 47.619 0.00 0.00 0.00 3.67
1236 1774 1.298667 GGTTTGGGCCGAGCTAGAA 59.701 57.895 7.62 0.00 0.00 2.10
1400 1958 7.040409 TCCAGCCTTCAATAAGAAAAACTCTTC 60.040 37.037 0.00 0.00 43.66 2.87
1603 2161 3.016736 CAATTGAACTACAATCCCCGCT 58.983 45.455 0.00 0.00 46.90 5.52
1731 2289 1.680314 CTTGCTCCCTGCCCCTTTC 60.680 63.158 0.00 0.00 42.00 2.62
1865 2426 6.403049 TCCACATATCGTATGTGTGTCTTTT 58.597 36.000 23.96 0.00 46.84 2.27


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.