Multiple sequence alignment - TraesCS1D01G070800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G070800 chr1D 100.000 2105 0 0 1 2105 51867016 51864912 0 3888
1 TraesCS1D01G070800 chr1D 96.888 1446 21 5 1 1426 254439951 254441392 0 2399
2 TraesCS1D01G070800 chr1D 96.567 699 14 6 1417 2105 254441473 254442171 0 1149
3 TraesCS1D01G070800 chr1D 98.614 505 5 2 1 505 491423479 491422977 0 893
4 TraesCS1D01G070800 chr5D 96.680 1446 25 4 1 1426 6171999 6170557 0 2383
5 TraesCS1D01G070800 chr5D 96.611 1446 24 5 1 1426 6271064 6269624 0 2375
6 TraesCS1D01G070800 chr5D 96.545 1447 25 4 1 1426 503296817 503298259 0 2372
7 TraesCS1D01G070800 chr5D 97.950 683 11 2 1426 2105 329161517 329160835 0 1181
8 TraesCS1D01G070800 chr5D 97.143 700 9 6 1417 2105 503298340 503299039 0 1171
9 TraesCS1D01G070800 chr5D 96.681 693 14 4 1422 2105 6269536 6268844 0 1144
10 TraesCS1D01G070800 chr5D 98.614 505 5 2 1 505 512414185 512414687 0 893
11 TraesCS1D01G070800 chr2D 96.266 1446 25 4 1 1426 638429347 638430783 0 2344
12 TraesCS1D01G070800 chr2D 96.857 700 11 6 1417 2105 638430864 638431563 0 1160
13 TraesCS1D01G070800 chr4D 95.297 1446 30 9 1 1426 19873426 19874853 0 2259
14 TraesCS1D01G070800 chr4D 97.459 669 12 5 1417 2080 19874934 19875602 0 1136
15 TraesCS1D01G070800 chr4B 95.107 1451 37 5 1 1426 308674852 308673411 0 2255
16 TraesCS1D01G070800 chr3D 92.228 1158 39 12 316 1426 235644625 235645778 0 1592
17 TraesCS1D01G070800 chr3D 97.496 679 9 3 1435 2105 24149198 24149876 0 1153
18 TraesCS1D01G070800 chr3D 97.976 593 10 2 834 1426 323520812 323521402 0 1027
19 TraesCS1D01G070800 chr4A 95.339 987 23 5 462 1426 309484656 309483671 0 1546
20 TraesCS1D01G070800 chr4A 97.230 686 16 3 1423 2105 309483582 309482897 0 1158
21 TraesCS1D01G070800 chr6D 98.251 686 8 3 1422 2105 437600679 437599996 0 1197
22 TraesCS1D01G070800 chr3B 94.280 472 7 1 495 946 796324519 796324990 0 704


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G070800 chr1D 51864912 51867016 2104 True 3888.0 3888 100.0000 1 2105 1 chr1D.!!$R1 2104
1 TraesCS1D01G070800 chr1D 254439951 254442171 2220 False 1774.0 2399 96.7275 1 2105 2 chr1D.!!$F1 2104
2 TraesCS1D01G070800 chr1D 491422977 491423479 502 True 893.0 893 98.6140 1 505 1 chr1D.!!$R2 504
3 TraesCS1D01G070800 chr5D 6170557 6171999 1442 True 2383.0 2383 96.6800 1 1426 1 chr5D.!!$R1 1425
4 TraesCS1D01G070800 chr5D 503296817 503299039 2222 False 1771.5 2372 96.8440 1 2105 2 chr5D.!!$F2 2104
5 TraesCS1D01G070800 chr5D 6268844 6271064 2220 True 1759.5 2375 96.6460 1 2105 2 chr5D.!!$R3 2104
6 TraesCS1D01G070800 chr5D 329160835 329161517 682 True 1181.0 1181 97.9500 1426 2105 1 chr5D.!!$R2 679
7 TraesCS1D01G070800 chr5D 512414185 512414687 502 False 893.0 893 98.6140 1 505 1 chr5D.!!$F1 504
8 TraesCS1D01G070800 chr2D 638429347 638431563 2216 False 1752.0 2344 96.5615 1 2105 2 chr2D.!!$F1 2104
9 TraesCS1D01G070800 chr4D 19873426 19875602 2176 False 1697.5 2259 96.3780 1 2080 2 chr4D.!!$F1 2079
10 TraesCS1D01G070800 chr4B 308673411 308674852 1441 True 2255.0 2255 95.1070 1 1426 1 chr4B.!!$R1 1425
11 TraesCS1D01G070800 chr3D 235644625 235645778 1153 False 1592.0 1592 92.2280 316 1426 1 chr3D.!!$F2 1110
12 TraesCS1D01G070800 chr3D 24149198 24149876 678 False 1153.0 1153 97.4960 1435 2105 1 chr3D.!!$F1 670
13 TraesCS1D01G070800 chr3D 323520812 323521402 590 False 1027.0 1027 97.9760 834 1426 1 chr3D.!!$F3 592
14 TraesCS1D01G070800 chr4A 309482897 309484656 1759 True 1352.0 1546 96.2845 462 2105 2 chr4A.!!$R1 1643
15 TraesCS1D01G070800 chr6D 437599996 437600679 683 True 1197.0 1197 98.2510 1422 2105 1 chr6D.!!$R1 683

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
724 752 2.745515 AGAAAGCTCGTGGGTTAGAC 57.254 50.0 0.0 0.0 34.95 2.59 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1826 2086 1.905839 TTGATCCATGGCCTTAGGGA 58.094 50.0 6.96 0.39 34.66 4.2 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
98 99 7.713750 AGACGAATCGAATCTTCTTATGGTTA 58.286 34.615 10.55 0.0 0.00 2.85
355 356 4.048571 AGGGAGGGAAGGCATATAGGAATA 59.951 45.833 0.00 0.0 0.00 1.75
389 391 8.080417 CACTACTCCCGATCGATAAAGATAAAA 58.920 37.037 18.66 0.0 0.00 1.52
608 620 7.285566 ACTGCTTATTTGGATGTCTATGTGAT 58.714 34.615 0.00 0.0 0.00 3.06
724 752 2.745515 AGAAAGCTCGTGGGTTAGAC 57.254 50.000 0.00 0.0 34.95 2.59
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
127 128 3.016736 CAATTGAACTACAATCCCCGCT 58.983 45.455 0.00 0.00 46.90 5.52
255 256 1.680314 CTTGCTCCCTGCCCCTTTC 60.680 63.158 0.00 0.00 42.00 2.62
389 391 6.403049 TCCACATATCGTATGTGTGTCTTTT 58.597 36.000 23.96 0.00 46.84 2.27
803 832 6.226272 ACATAGGAAGATCCTCTATCCACT 57.774 41.667 1.36 0.00 45.66 4.00
997 1046 8.450578 AATGCGAGAATATTGACTTCCATAAA 57.549 30.769 0.00 0.00 0.00 1.40
1154 1203 8.118600 AGATCCTTCCATTTAAGACTTGGATTT 58.881 33.333 0.00 0.00 39.22 2.17
1172 1222 6.887002 AGTTTAAGATTCCAACCAGATCCTTC 59.113 38.462 0.00 0.00 0.00 3.46
1826 2086 1.905839 TTGATCCATGGCCTTAGGGA 58.094 50.000 6.96 0.39 34.66 4.20


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.