Multiple sequence alignment - TraesCS1D01G070600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G070600 chr1D 100.000 2246 0 0 1 2246 51833302 51831057 0 4148
1 TraesCS1D01G070600 chr1D 96.810 2257 50 11 1 2246 254458074 254460319 0 3749
2 TraesCS1D01G070600 chr3A 97.346 2261 41 12 1 2246 105558304 105556048 0 3825
3 TraesCS1D01G070600 chr5D 97.172 2263 45 11 1 2246 6254627 6252367 0 3807
4 TraesCS1D01G070600 chr5D 97.077 2258 49 12 1 2246 503338096 503340348 0 3788
5 TraesCS1D01G070600 chr5D 96.893 2253 58 8 1 2246 503312161 503314408 0 3762
6 TraesCS1D01G070600 chr5D 97.479 2182 38 9 68 2237 299973782 299971606 0 3709
7 TraesCS1D01G070600 chr7B 97.166 2258 47 10 1 2246 662756376 662754124 0 3799
8 TraesCS1D01G070600 chr1B 97.119 2256 50 10 1 2246 633715630 633717880 0 3792
9 TraesCS1D01G070600 chr5B 97.037 2261 48 11 1 2246 57516470 57514214 0 3786


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G070600 chr1D 51831057 51833302 2245 True 4148 4148 100.000 1 2246 1 chr1D.!!$R1 2245
1 TraesCS1D01G070600 chr1D 254458074 254460319 2245 False 3749 3749 96.810 1 2246 1 chr1D.!!$F1 2245
2 TraesCS1D01G070600 chr3A 105556048 105558304 2256 True 3825 3825 97.346 1 2246 1 chr3A.!!$R1 2245
3 TraesCS1D01G070600 chr5D 6252367 6254627 2260 True 3807 3807 97.172 1 2246 1 chr5D.!!$R1 2245
4 TraesCS1D01G070600 chr5D 503338096 503340348 2252 False 3788 3788 97.077 1 2246 1 chr5D.!!$F2 2245
5 TraesCS1D01G070600 chr5D 503312161 503314408 2247 False 3762 3762 96.893 1 2246 1 chr5D.!!$F1 2245
6 TraesCS1D01G070600 chr5D 299971606 299973782 2176 True 3709 3709 97.479 68 2237 1 chr5D.!!$R2 2169
7 TraesCS1D01G070600 chr7B 662754124 662756376 2252 True 3799 3799 97.166 1 2246 1 chr7B.!!$R1 2245
8 TraesCS1D01G070600 chr1B 633715630 633717880 2250 False 3792 3792 97.119 1 2246 1 chr1B.!!$F1 2245
9 TraesCS1D01G070600 chr5B 57514214 57516470 2256 True 3786 3786 97.037 1 2246 1 chr5B.!!$R1 2245

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
75 76 3.518766 CCATGGGGAATTAGCAGCA 57.481 52.632 2.85 0.0 35.59 4.41 F
1039 1066 2.679837 GCTGCTTCTGTTATTGCTGCTA 59.320 45.455 0.00 0.0 43.59 3.49 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1207 1242 3.734902 GCAAATAAAAGCGCTAGTGCCAT 60.735 43.478 24.25 11.37 35.36 4.40 R
1932 1982 8.740123 TCTTCAGAAGTAATTCGTAGAGATCT 57.260 34.615 10.09 0.00 38.43 2.75 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
75 76 3.518766 CCATGGGGAATTAGCAGCA 57.481 52.632 2.85 0.00 35.59 4.41
99 102 6.807230 CACCCACGAGATATAAATACTACTGC 59.193 42.308 0.00 0.00 0.00 4.40
117 120 7.560368 ACTACTGCTGCTTTATCTTTACTCAT 58.440 34.615 0.00 0.00 0.00 2.90
274 277 4.513692 CGACTTTTCGGGAATATATTGGCA 59.486 41.667 1.78 0.00 41.89 4.92
392 395 5.868801 GCTCTTATTTTTGCAACATTAGCCA 59.131 36.000 0.00 0.00 0.00 4.75
395 398 6.644592 TCTTATTTTTGCAACATTAGCCACAC 59.355 34.615 0.00 0.00 0.00 3.82
841 867 8.748179 ATCCGATATATGGATATGGAATTCCT 57.252 34.615 24.73 12.90 44.38 3.36
1039 1066 2.679837 GCTGCTTCTGTTATTGCTGCTA 59.320 45.455 0.00 0.00 43.59 3.49
1402 1442 6.945636 ATTTATCGGGACAGATAATACCCA 57.054 37.500 0.00 0.00 41.19 4.51
1465 1505 7.385894 AGATATGCTCACCTTCTTATTTCCT 57.614 36.000 0.00 0.00 0.00 3.36
1491 1531 6.002082 TCCTTAGTTTAGGAAAGTGGAAAGC 58.998 40.000 0.00 0.00 41.33 3.51
1671 1715 8.432359 GTGATCGAAAAACTTTGTTCTTTGTTT 58.568 29.630 0.00 0.00 34.59 2.83
1885 1935 4.837298 AGATTGGATCTATCTAGCTGCACA 59.163 41.667 1.02 0.00 38.00 4.57
1932 1982 5.946972 TCGGATAAATAAGAAAAGGGTGCAA 59.053 36.000 0.00 0.00 0.00 4.08
1939 1989 4.379302 AAGAAAAGGGTGCAAGATCTCT 57.621 40.909 0.00 0.00 0.00 3.10
1956 2006 9.232082 CAAGATCTCTACGAATTACTTCTGAAG 57.768 37.037 15.59 15.59 0.00 3.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
75 76 6.720288 AGCAGTAGTATTTATATCTCGTGGGT 59.280 38.462 0.00 0.00 0.00 4.51
99 102 6.509199 CGCTGACATGAGTAAAGATAAAGCAG 60.509 42.308 0.00 0.00 0.00 4.24
107 110 1.275010 TGCCGCTGACATGAGTAAAGA 59.725 47.619 0.00 0.00 0.00 2.52
117 120 3.963665 GCATAAAAATATGCCGCTGACA 58.036 40.909 9.17 0.00 45.16 3.58
274 277 7.226720 ACAAGAACAACAACGACTAATTCATCT 59.773 33.333 0.00 0.00 0.00 2.90
395 398 5.367937 CCTCCATGGATTCACCTATATAGGG 59.632 48.000 28.62 18.70 42.52 3.53
841 867 7.156000 TGTGAATTGTCCGAACTACATAGAAA 58.844 34.615 0.00 0.00 0.00 2.52
985 1012 4.536090 TGGATTCATGGTGAGTAGTTCCTT 59.464 41.667 0.00 0.00 0.00 3.36
1207 1242 3.734902 GCAAATAAAAGCGCTAGTGCCAT 60.735 43.478 24.25 11.37 35.36 4.40
1402 1442 3.846588 TCAACTCAGCCCTTCCTAGAATT 59.153 43.478 0.00 0.00 0.00 2.17
1465 1505 6.503560 TTCCACTTTCCTAAACTAAGGACA 57.496 37.500 0.00 0.00 45.49 4.02
1671 1715 6.455690 TGCTCTCCTCTTATAGATAGGACA 57.544 41.667 0.00 0.00 34.46 4.02
1794 1840 5.603596 TCAAACACGAACCACTACAGTTAT 58.396 37.500 0.00 0.00 0.00 1.89
1932 1982 8.740123 TCTTCAGAAGTAATTCGTAGAGATCT 57.260 34.615 10.09 0.00 38.43 2.75
1956 2006 9.741647 GGTTCTTCCATATGATTTCTGAATTTC 57.258 33.333 3.65 0.00 35.97 2.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.