Multiple sequence alignment - TraesCS1D01G070500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G070500 chr1D 100.000 2264 0 0 1 2264 51831506 51829243 0 4181
1 TraesCS1D01G070500 chr5D 97.228 2273 50 9 1 2264 503339896 503342164 0 3836
2 TraesCS1D01G070500 chr5D 97.550 2245 40 10 1 2234 299971537 299969297 0 3827
3 TraesCS1D01G070500 chr5D 96.743 2272 63 9 1 2264 503313957 503316225 0 3775
4 TraesCS1D01G070500 chr5D 96.697 2271 63 10 1 2264 6252818 6250553 0 3768
5 TraesCS1D01G070500 chrUn 97.050 2271 57 8 1 2264 261568237 261565970 0 3814
6 TraesCS1D01G070500 chr1A 96.848 2284 45 11 1 2264 554482468 554484744 0 3794
7 TraesCS1D01G070500 chr5A 97.205 2254 39 9 23 2264 559031468 559029227 0 3792
8 TraesCS1D01G070500 chr5B 96.790 2274 49 9 4 2264 57514664 57512402 0 3773
9 TraesCS1D01G070500 chr7A 95.995 2272 76 13 1 2264 537840953 537838689 0 3677
10 TraesCS1D01G070500 chr4D 95.290 2272 90 14 1 2264 19901180 19903442 0 3587
11 TraesCS1D01G070500 chr7B 95.979 1492 37 11 1 1481 662754577 662753098 0 2401


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G070500 chr1D 51829243 51831506 2263 True 4181 4181 100.000 1 2264 1 chr1D.!!$R1 2263
1 TraesCS1D01G070500 chr5D 503339896 503342164 2268 False 3836 3836 97.228 1 2264 1 chr5D.!!$F2 2263
2 TraesCS1D01G070500 chr5D 299969297 299971537 2240 True 3827 3827 97.550 1 2234 1 chr5D.!!$R2 2233
3 TraesCS1D01G070500 chr5D 503313957 503316225 2268 False 3775 3775 96.743 1 2264 1 chr5D.!!$F1 2263
4 TraesCS1D01G070500 chr5D 6250553 6252818 2265 True 3768 3768 96.697 1 2264 1 chr5D.!!$R1 2263
5 TraesCS1D01G070500 chrUn 261565970 261568237 2267 True 3814 3814 97.050 1 2264 1 chrUn.!!$R1 2263
6 TraesCS1D01G070500 chr1A 554482468 554484744 2276 False 3794 3794 96.848 1 2264 1 chr1A.!!$F1 2263
7 TraesCS1D01G070500 chr5A 559029227 559031468 2241 True 3792 3792 97.205 23 2264 1 chr5A.!!$R1 2241
8 TraesCS1D01G070500 chr5B 57512402 57514664 2262 True 3773 3773 96.790 4 2264 1 chr5B.!!$R1 2260
9 TraesCS1D01G070500 chr7A 537838689 537840953 2264 True 3677 3677 95.995 1 2264 1 chr7A.!!$R1 2263
10 TraesCS1D01G070500 chr4D 19901180 19903442 2262 False 3587 3587 95.290 1 2264 1 chr4D.!!$F1 2263
11 TraesCS1D01G070500 chr7B 662753098 662754577 1479 True 2401 2401 95.979 1 1481 1 chr7B.!!$R1 1480

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
466 473 1.276145 GCCGAATCGACGACCTATGC 61.276 60.0 3.36 0.0 35.09 3.14 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2032 2059 0.532115 GCAGGTGAATCCGCCATTTT 59.468 50.0 0.0 0.0 45.32 1.82 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
89 92 4.837298 AGATTGGATCTATCTAGCTGCACA 59.163 41.667 1.02 0.00 38.00 4.57
136 139 5.946972 TCGGATAAATAAGAAAAGGGTGCAA 59.053 36.000 0.00 0.00 0.00 4.08
143 146 4.379302 AAGAAAAGGGTGCAAGATCTCT 57.621 40.909 0.00 0.00 0.00 3.10
160 163 9.232082 CAAGATCTCTACGAATTACTTCTGAAG 57.768 37.037 15.59 15.59 0.00 3.02
466 473 1.276145 GCCGAATCGACGACCTATGC 61.276 60.000 3.36 0.00 35.09 3.14
739 749 6.842676 AGAGGATAGGCCCATTACTTAAAAG 58.157 40.000 0.00 0.00 37.37 2.27
790 815 1.739466 GCGTGAGAGCCAAATGAATCA 59.261 47.619 0.00 0.00 0.00 2.57
1090 1116 8.314751 TGGAACAATTGGAAAAGTCTAAAAACA 58.685 29.630 10.83 0.00 31.92 2.83
1139 1165 0.904649 ATGAATCAGGTCCGACAGCA 59.095 50.000 0.00 0.00 0.00 4.41
1140 1166 0.684535 TGAATCAGGTCCGACAGCAA 59.315 50.000 0.00 0.00 0.00 3.91
1181 1207 3.297134 AGGAGCTCTAGGAACTCTGAG 57.703 52.381 14.64 2.45 41.75 3.35
1240 1266 4.702831 TCGTGCTAATATTGGCATTCTCA 58.297 39.130 26.54 8.84 46.33 3.27
1316 1342 9.698617 ACTTTCGTTTAGAATTTACGCATTATC 57.301 29.630 0.00 0.00 38.86 1.75
1394 1421 7.549488 AGTCGACGAAATTCATAAAATTCTCCT 59.451 33.333 10.46 0.00 0.00 3.69
1482 1509 4.567747 GGGGATGGGATTGCTCGTATTATT 60.568 45.833 0.00 0.00 0.00 1.40
1613 1640 4.290985 TGGGTTGATGATACAAGAGGGAAA 59.709 41.667 0.00 0.00 0.00 3.13
1901 1928 4.494091 AAACAGCAGTAGCCACAGATAT 57.506 40.909 0.00 0.00 43.56 1.63
2032 2059 8.803235 CCATGGAATACACTATTGTAGTAGCTA 58.197 37.037 5.56 0.00 41.62 3.32
2056 2083 1.090052 GGCGGATTCACCTGCTACAC 61.090 60.000 0.00 0.00 37.93 2.90
2071 2098 4.201657 TGCTACACTACAATACCTCGCTA 58.798 43.478 0.00 0.00 0.00 4.26
2189 2216 4.879545 TCGCCAAATGTCCCTTCTATTAAC 59.120 41.667 0.00 0.00 0.00 2.01
2204 2231 1.128809 TTAACAAGACCTCCCGGCCA 61.129 55.000 2.24 0.00 0.00 5.36
2253 2281 3.829886 TTGCATTCACGCCTTTTAGAG 57.170 42.857 0.00 0.00 0.00 2.43
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
136 139 8.740123 TCTTCAGAAGTAATTCGTAGAGATCT 57.260 34.615 10.09 0.0 38.43 2.75
160 163 9.741647 GGTTCTTCCATATGATTTCTGAATTTC 57.258 33.333 3.65 0.0 35.97 2.17
790 815 4.586841 TCCCGAACCAAACATGAATCTTTT 59.413 37.500 0.00 0.0 0.00 2.27
1139 1165 1.951602 GTACGGCCTGTTGGAAAACTT 59.048 47.619 0.00 0.0 34.57 2.66
1140 1166 1.134037 TGTACGGCCTGTTGGAAAACT 60.134 47.619 0.00 0.0 34.57 2.66
1181 1207 7.642071 TGTAACTCGGTATTCAAACAACTAC 57.358 36.000 0.00 0.0 0.00 2.73
1240 1266 1.081174 TCTCTTCCATTCCAGGGACCT 59.919 52.381 0.00 0.0 33.18 3.85
1308 1334 2.301346 AGCAAGGGGAAAGATAATGCG 58.699 47.619 0.00 0.0 37.40 4.73
1316 1342 1.616159 TTTCGGAAGCAAGGGGAAAG 58.384 50.000 0.00 0.0 0.00 2.62
1482 1509 5.009631 CCTGACATTATTTCACCAAGACCA 58.990 41.667 0.00 0.0 0.00 4.02
1613 1640 8.829612 CAATTCTTCCTGTTGCTTTTACAAAAT 58.170 29.630 0.00 0.0 0.00 1.82
1643 1670 1.400737 AGCCTCACTCACGGGTATAC 58.599 55.000 0.00 0.0 0.00 1.47
1644 1671 2.154567 AAGCCTCACTCACGGGTATA 57.845 50.000 0.00 0.0 0.00 1.47
1901 1928 6.269769 ACCTTGCCCTTTTTGATTGAGAATTA 59.730 34.615 0.00 0.0 0.00 1.40
2032 2059 0.532115 GCAGGTGAATCCGCCATTTT 59.468 50.000 0.00 0.0 45.32 1.82
2056 2083 6.402983 CCCGTATAAGTAGCGAGGTATTGTAG 60.403 46.154 0.00 0.0 0.00 2.74
2204 2231 1.991070 CATCCCCTGGATAAGCCTCAT 59.009 52.381 0.00 0.0 40.98 2.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.