Multiple sequence alignment - TraesCS1D01G069200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G069200 chr1D 100.000 2275 0 0 1 2275 50111642 50109368 0.000000e+00 4202
1 TraesCS1D01G069200 chr1D 87.436 1942 218 17 351 2275 49975946 49974014 0.000000e+00 2211
2 TraesCS1D01G069200 chr1D 90.060 1670 161 3 607 2275 50009794 50008129 0.000000e+00 2159
3 TraesCS1D01G069200 chr1D 88.478 1675 178 13 607 2275 50025039 50023374 0.000000e+00 2010
4 TraesCS1D01G069200 chr1D 85.852 1866 243 8 418 2275 49958905 49957053 0.000000e+00 1964
5 TraesCS1D01G069200 chr1D 89.366 1072 85 13 131 1186 80652768 80651710 0.000000e+00 1321
6 TraesCS1D01G069200 chr1D 82.555 321 38 9 3 317 49960029 49959721 1.340000e-67 267
7 TraesCS1D01G069200 chr1D 90.816 98 7 2 1 98 80652865 80652770 1.830000e-26 130
8 TraesCS1D01G069200 chr1B 97.416 2283 47 2 1 2275 70697226 70694948 0.000000e+00 3879
9 TraesCS1D01G069200 chr1B 86.170 1851 226 16 439 2275 70336403 70334569 0.000000e+00 1973
10 TraesCS1D01G069200 chr1B 85.383 1252 143 14 356 1583 70498716 70497481 0.000000e+00 1262
11 TraesCS1D01G069200 chr1A 96.949 2294 51 3 1 2275 49357870 49355577 0.000000e+00 3831
12 TraesCS1D01G069200 chr1A 88.208 1942 207 14 351 2275 49349479 49347543 0.000000e+00 2298
13 TraesCS1D01G069200 chr1A 86.440 1851 221 16 439 2275 49296008 49294174 0.000000e+00 2001


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G069200 chr1D 50109368 50111642 2274 True 4202.0 4202 100.0000 1 2275 1 chr1D.!!$R4 2274
1 TraesCS1D01G069200 chr1D 49974014 49975946 1932 True 2211.0 2211 87.4360 351 2275 1 chr1D.!!$R1 1924
2 TraesCS1D01G069200 chr1D 50008129 50009794 1665 True 2159.0 2159 90.0600 607 2275 1 chr1D.!!$R2 1668
3 TraesCS1D01G069200 chr1D 50023374 50025039 1665 True 2010.0 2010 88.4780 607 2275 1 chr1D.!!$R3 1668
4 TraesCS1D01G069200 chr1D 49957053 49960029 2976 True 1115.5 1964 84.2035 3 2275 2 chr1D.!!$R5 2272
5 TraesCS1D01G069200 chr1D 80651710 80652865 1155 True 725.5 1321 90.0910 1 1186 2 chr1D.!!$R6 1185
6 TraesCS1D01G069200 chr1B 70694948 70697226 2278 True 3879.0 3879 97.4160 1 2275 1 chr1B.!!$R3 2274
7 TraesCS1D01G069200 chr1B 70334569 70336403 1834 True 1973.0 1973 86.1700 439 2275 1 chr1B.!!$R1 1836
8 TraesCS1D01G069200 chr1B 70497481 70498716 1235 True 1262.0 1262 85.3830 356 1583 1 chr1B.!!$R2 1227
9 TraesCS1D01G069200 chr1A 49355577 49357870 2293 True 3831.0 3831 96.9490 1 2275 1 chr1A.!!$R3 2274
10 TraesCS1D01G069200 chr1A 49347543 49349479 1936 True 2298.0 2298 88.2080 351 2275 1 chr1A.!!$R2 1924
11 TraesCS1D01G069200 chr1A 49294174 49296008 1834 True 2001.0 2001 86.4400 439 2275 1 chr1A.!!$R1 1836

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
311 330 5.809562 TGTCCAAAAATGCAAACACTGTTAG 59.19 36.0 0.0 0.0 0.0 2.34 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1646 2421 0.756903 AGTACAGCCGGACACAGTTT 59.243 50.0 5.05 0.0 0.0 2.66 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
160 161 8.989653 TGTTCGAATAAGTCACACACATATTA 57.010 30.769 0.00 0.0 30.59 0.98
311 330 5.809562 TGTCCAAAAATGCAAACACTGTTAG 59.190 36.000 0.00 0.0 0.00 2.34
1034 1805 8.846943 AGTGTTGTGATATTGAACTTCACATA 57.153 30.769 11.35 3.9 46.46 2.29
1272 2047 5.904941 TGCAACATTTGTCTGAACAGAATT 58.095 33.333 6.08 0.0 39.48 2.17
1646 2421 7.554959 AGAACTGAACTAGGGAGTGATAAAA 57.445 36.000 0.00 0.0 35.52 1.52
1669 2444 2.118732 TGTCCGGCTGTACTCCCA 59.881 61.111 0.00 0.0 0.00 4.37
2075 2850 2.933906 TGAACGAGTTCCAAGTGACAAC 59.066 45.455 12.76 0.0 38.77 3.32
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
311 330 3.119101 TCCCTGAGTTAATCGAGCTGAAC 60.119 47.826 0.00 0.0 0.00 3.18
1034 1805 5.643379 ATTCCAGAAATTACGTGCAATGT 57.357 34.783 0.00 0.0 40.66 2.71
1118 1890 5.359009 AGTGGAATAATGGTGAGCATTTCTG 59.641 40.000 15.51 0.0 0.00 3.02
1272 2047 3.071023 GTGGAAGGATCGATGATGGGTTA 59.929 47.826 0.54 0.0 0.00 2.85
1646 2421 0.756903 AGTACAGCCGGACACAGTTT 59.243 50.000 5.05 0.0 0.00 2.66
1669 2444 4.908601 TCAGTCAGATGGTTGTTGGTAT 57.091 40.909 0.00 0.0 0.00 2.73
2093 2868 6.645790 AAATGTTCAGAGAAATGACAAGCT 57.354 33.333 0.00 0.0 0.00 3.74
2229 3004 1.462731 AAGCCGGAGCAATGCACAAA 61.463 50.000 5.05 0.0 43.56 2.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.