Multiple sequence alignment - TraesCS1D01G063700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G063700 chr1D 100.000 2468 0 0 1 2468 44274397 44276864 0.000000e+00 4558
1 TraesCS1D01G063700 chr1D 93.939 2508 91 28 1 2468 43822480 43824966 0.000000e+00 3733
2 TraesCS1D01G063700 chr1D 97.471 1384 33 1 1 1384 44309597 44310978 0.000000e+00 2361
3 TraesCS1D01G063700 chr1D 94.571 1400 50 6 683 2056 44628962 44630361 0.000000e+00 2141
4 TraesCS1D01G063700 chr1D 95.264 1098 43 5 1377 2468 44370303 44371397 0.000000e+00 1731
5 TraesCS1D01G063700 chr1D 88.165 1090 88 14 627 1677 43305828 43306915 0.000000e+00 1260
6 TraesCS1D01G063700 chr1D 98.084 574 11 0 623 1196 44159096 44159669 0.000000e+00 1000
7 TraesCS1D01G063700 chr1D 94.881 586 26 4 1885 2468 44160031 44160614 0.000000e+00 913
8 TraesCS1D01G063700 chr1D 94.444 342 15 2 1 338 44158755 44159096 7.820000e-145 523
9 TraesCS1D01G063700 chr1B 90.605 1884 136 18 616 2468 63479635 63481508 0.000000e+00 2460
10 TraesCS1D01G063700 chr1B 90.474 1879 133 16 622 2468 63759037 63760901 0.000000e+00 2436
11 TraesCS1D01G063700 chr1B 89.809 1884 140 22 616 2468 63808647 63810509 0.000000e+00 2368
12 TraesCS1D01G063700 chr1B 89.761 1885 141 23 616 2468 63468403 63470267 0.000000e+00 2364
13 TraesCS1D01G063700 chr1B 91.559 1398 87 18 616 1986 63614045 63615438 0.000000e+00 1899
14 TraesCS1D01G063700 chr1B 92.035 1155 62 7 616 1741 63888935 63890088 0.000000e+00 1596
15 TraesCS1D01G063700 chr1B 90.783 217 17 2 1 216 63808425 63808639 1.120000e-73 287
16 TraesCS1D01G063700 chr1B 90.278 216 19 1 1 216 63613824 63614037 5.200000e-72 281
17 TraesCS1D01G063700 chr1B 90.278 216 17 4 3 216 63888714 63888927 1.870000e-71 279
18 TraesCS1D01G063700 chr1B 89.815 216 20 1 1 216 63468182 63468395 2.420000e-70 276
19 TraesCS1D01G063700 chr1B 89.815 216 20 1 1 216 63479414 63479627 2.420000e-70 276
20 TraesCS1D01G063700 chr1B 94.118 119 7 0 202 320 88542206 88542088 5.420000e-42 182
21 TraesCS1D01G063700 chr1A 90.507 1875 127 23 627 2468 43271785 43269929 0.000000e+00 2429
22 TraesCS1D01G063700 chr1A 88.711 1878 133 31 627 2468 43392401 43390567 0.000000e+00 2220
23 TraesCS1D01G063700 chr1A 91.667 216 16 1 1 216 43392634 43392421 5.160000e-77 298
24 TraesCS1D01G063700 chr3D 86.228 668 77 10 1809 2468 600565971 600565311 0.000000e+00 710
25 TraesCS1D01G063700 chr3D 94.097 288 14 1 338 622 111181233 111181520 3.770000e-118 435
26 TraesCS1D01G063700 chr3D 96.491 114 3 1 209 322 589199574 589199462 1.170000e-43 187
27 TraesCS1D01G063700 chr7D 85.326 552 64 11 1925 2468 53257841 53258383 2.770000e-154 555
28 TraesCS1D01G063700 chr7D 94.700 283 14 1 341 622 550980000 550979718 2.910000e-119 438
29 TraesCS1D01G063700 chr7D 94.056 286 16 1 338 622 509235900 509235615 1.360000e-117 433
30 TraesCS1D01G063700 chr2D 94.810 289 15 0 336 624 371841091 371841379 3.740000e-123 451
31 TraesCS1D01G063700 chr2D 90.977 133 10 2 214 346 460725345 460725215 7.010000e-41 178
32 TraesCS1D01G063700 chr4D 94.035 285 17 0 338 622 329463329 329463613 1.360000e-117 433
33 TraesCS1D01G063700 chr5B 94.035 285 16 1 338 622 513963519 513963802 4.880000e-117 431
34 TraesCS1D01G063700 chr6D 92.833 293 19 2 330 622 24480127 24479837 8.160000e-115 424
35 TraesCS1D01G063700 chr7B 96.667 120 4 0 201 320 420072677 420072796 1.500000e-47 200
36 TraesCS1D01G063700 chr7B 92.481 133 5 4 200 328 58655882 58656013 4.190000e-43 185
37 TraesCS1D01G063700 chr4B 94.828 116 6 0 205 320 60204678 60204563 5.420000e-42 182


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G063700 chr1D 44274397 44276864 2467 False 4558.0 4558 100.0000 1 2468 1 chr1D.!!$F3 2467
1 TraesCS1D01G063700 chr1D 43822480 43824966 2486 False 3733.0 3733 93.9390 1 2468 1 chr1D.!!$F2 2467
2 TraesCS1D01G063700 chr1D 44309597 44310978 1381 False 2361.0 2361 97.4710 1 1384 1 chr1D.!!$F4 1383
3 TraesCS1D01G063700 chr1D 44628962 44630361 1399 False 2141.0 2141 94.5710 683 2056 1 chr1D.!!$F6 1373
4 TraesCS1D01G063700 chr1D 44370303 44371397 1094 False 1731.0 1731 95.2640 1377 2468 1 chr1D.!!$F5 1091
5 TraesCS1D01G063700 chr1D 43305828 43306915 1087 False 1260.0 1260 88.1650 627 1677 1 chr1D.!!$F1 1050
6 TraesCS1D01G063700 chr1D 44158755 44160614 1859 False 812.0 1000 95.8030 1 2468 3 chr1D.!!$F7 2467
7 TraesCS1D01G063700 chr1B 63759037 63760901 1864 False 2436.0 2436 90.4740 622 2468 1 chr1B.!!$F1 1846
8 TraesCS1D01G063700 chr1B 63479414 63481508 2094 False 1368.0 2460 90.2100 1 2468 2 chr1B.!!$F3 2467
9 TraesCS1D01G063700 chr1B 63808425 63810509 2084 False 1327.5 2368 90.2960 1 2468 2 chr1B.!!$F5 2467
10 TraesCS1D01G063700 chr1B 63468182 63470267 2085 False 1320.0 2364 89.7880 1 2468 2 chr1B.!!$F2 2467
11 TraesCS1D01G063700 chr1B 63613824 63615438 1614 False 1090.0 1899 90.9185 1 1986 2 chr1B.!!$F4 1985
12 TraesCS1D01G063700 chr1B 63888714 63890088 1374 False 937.5 1596 91.1565 3 1741 2 chr1B.!!$F6 1738
13 TraesCS1D01G063700 chr1A 43269929 43271785 1856 True 2429.0 2429 90.5070 627 2468 1 chr1A.!!$R1 1841
14 TraesCS1D01G063700 chr1A 43390567 43392634 2067 True 1259.0 2220 90.1890 1 2468 2 chr1A.!!$R2 2467
15 TraesCS1D01G063700 chr3D 600565311 600565971 660 True 710.0 710 86.2280 1809 2468 1 chr3D.!!$R2 659
16 TraesCS1D01G063700 chr7D 53257841 53258383 542 False 555.0 555 85.3260 1925 2468 1 chr7D.!!$F1 543

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
970 996 0.902531 TCAAAGGGGTAGAGAAGGCG 59.097 55.0 0.0 0.0 0.0 5.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1989 2350 1.471119 GTAGACACCATGACCCTCGA 58.529 55.0 0.0 0.0 0.0 4.04 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
66 67 7.416817 TGTAGCATGTACATGTGCAATTAATC 58.583 34.615 31.10 14.22 43.63 1.75
386 394 7.834068 AAGACTAGTAACATGCATGTGTTAG 57.166 36.000 31.98 28.95 43.16 2.34
849 863 6.056884 TCAAGATATACAACTGATGCATGCA 58.943 36.000 25.04 25.04 0.00 3.96
970 996 0.902531 TCAAAGGGGTAGAGAAGGCG 59.097 55.000 0.00 0.00 0.00 5.52
1417 1753 7.071069 AGTGCTATTCTGATCATATGTTGGA 57.929 36.000 1.90 0.00 0.00 3.53
1464 1800 1.051812 CATTCCCTCCTCTGGCGTAT 58.948 55.000 0.00 0.00 0.00 3.06
1517 1858 3.429410 GGCTTTTACATTCCATGTGCCTC 60.429 47.826 8.13 0.00 44.60 4.70
1607 1948 5.756347 AGCACTTTGTATGAGAACGTTTGTA 59.244 36.000 0.46 0.00 0.00 2.41
1905 2262 2.348666 CGACTTGATTTCCTAAGGCACG 59.651 50.000 0.00 0.00 31.26 5.34
2188 2558 8.821147 TTTACACGACTCACATGTACTAAATT 57.179 30.769 0.00 0.00 0.00 1.82
2268 2644 9.545105 TTTGTTCATTATTTGCAGATCTGTTTT 57.455 25.926 23.38 9.24 0.00 2.43
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
66 67 3.612423 TGCATCGAAGAATGAACGTGTAG 59.388 43.478 0.00 0.00 43.58 2.74
174 178 6.914259 TCTCGAAGATATGGTACTGCATAAG 58.086 40.000 0.00 0.00 33.89 1.73
218 223 5.562696 TACGACAAGTAATTCCGAACGAAGT 60.563 40.000 0.00 0.00 35.08 3.01
221 226 3.287312 ACGACAAGTAATTCCGAACGA 57.713 42.857 0.00 0.00 0.00 3.85
362 370 7.386851 ACTAACACATGCATGTTACTAGTCTT 58.613 34.615 29.48 12.11 42.73 3.01
380 388 9.612066 AGAGGTAGTAACATAGACTACTAACAC 57.388 37.037 11.55 1.63 45.71 3.32
751 763 5.061853 AGGCTGCATCATACATTAGTTCTG 58.938 41.667 0.50 0.00 0.00 3.02
849 863 6.066690 CCTTGTTTGAGATGATGATATGGGT 58.933 40.000 0.00 0.00 0.00 4.51
1082 1108 0.257039 ACACTCCTTGATCATGGCCC 59.743 55.000 20.32 0.00 0.00 5.80
1417 1753 4.529377 ACCTGCAAGACCATTCAATTTGAT 59.471 37.500 0.00 0.00 34.07 2.57
1464 1800 4.157246 TCCCACAGCTAAACTAGAGTCAA 58.843 43.478 0.00 0.00 0.00 3.18
1517 1858 2.029838 AGGAAAGCTATTGTGAGGCG 57.970 50.000 0.00 0.00 0.00 5.52
1619 1960 9.981460 ATAATTTAGACAATTTGAGGAGAAGGT 57.019 29.630 2.79 0.00 0.00 3.50
1874 2231 5.551233 AGGAAATCAAGTCGTGATGAGAAA 58.449 37.500 1.78 0.00 46.80 2.52
1875 2232 5.152623 AGGAAATCAAGTCGTGATGAGAA 57.847 39.130 1.78 0.00 46.80 2.87
1989 2350 1.471119 GTAGACACCATGACCCTCGA 58.529 55.000 0.00 0.00 0.00 4.04


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.