Multiple sequence alignment - TraesCS1D01G063300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G063300 chr1D 100.000 2439 0 0 1 2439 43235401 43237839 0 4505
1 TraesCS1D01G063300 chr1D 97.951 2440 41 5 5 2439 269408396 269405961 0 4220
2 TraesCS1D01G063300 chr7D 98.481 2436 31 3 5 2439 381972174 381974604 0 4289
3 TraesCS1D01G063300 chr7D 98.443 2440 31 5 5 2439 382051675 382049238 0 4289
4 TraesCS1D01G063300 chr7D 98.321 2442 32 3 5 2439 381925597 381923158 0 4274
5 TraesCS1D01G063300 chr7D 98.320 2441 31 6 6 2439 203501594 203499157 0 4272
6 TraesCS1D01G063300 chr6D 98.320 2440 34 3 5 2439 124519118 124516681 0 4272
7 TraesCS1D01G063300 chr5A 98.161 2447 31 7 5 2439 19247247 19249691 0 4257
8 TraesCS1D01G063300 chr1A 98.078 2445 37 7 1 2439 498689627 498692067 0 4246
9 TraesCS1D01G063300 chr7B 98.076 2443 35 5 5 2439 716877185 716879623 0 4241


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G063300 chr1D 43235401 43237839 2438 False 4505 4505 100.000 1 2439 1 chr1D.!!$F1 2438
1 TraesCS1D01G063300 chr1D 269405961 269408396 2435 True 4220 4220 97.951 5 2439 1 chr1D.!!$R1 2434
2 TraesCS1D01G063300 chr7D 381972174 381974604 2430 False 4289 4289 98.481 5 2439 1 chr7D.!!$F1 2434
3 TraesCS1D01G063300 chr7D 382049238 382051675 2437 True 4289 4289 98.443 5 2439 1 chr7D.!!$R3 2434
4 TraesCS1D01G063300 chr7D 381923158 381925597 2439 True 4274 4274 98.321 5 2439 1 chr7D.!!$R2 2434
5 TraesCS1D01G063300 chr7D 203499157 203501594 2437 True 4272 4272 98.320 6 2439 1 chr7D.!!$R1 2433
6 TraesCS1D01G063300 chr6D 124516681 124519118 2437 True 4272 4272 98.320 5 2439 1 chr6D.!!$R1 2434
7 TraesCS1D01G063300 chr5A 19247247 19249691 2444 False 4257 4257 98.161 5 2439 1 chr5A.!!$F1 2434
8 TraesCS1D01G063300 chr1A 498689627 498692067 2440 False 4246 4246 98.078 1 2439 1 chr1A.!!$F1 2438
9 TraesCS1D01G063300 chr7B 716877185 716879623 2438 False 4241 4241 98.076 5 2439 1 chr7B.!!$F1 2434

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
831 832 0.904649 TCCATCAGACGGCTGTTCAT 59.095 50.0 19.93 0.71 42.84 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2237 2256 0.463204 GCTTCCGAGGGTTAGGGTAC 59.537 60.0 0.0 0.0 0.0 3.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
590 591 2.878406 GGCGCAATAGAAAGGAATGCTA 59.122 45.455 10.83 0.00 34.93 3.49
692 693 2.851045 GGGGTTTCTTGGGGCTCA 59.149 61.111 0.00 0.00 0.00 4.26
734 735 2.352323 CCCACAAGTTGTTAATTCGCCC 60.352 50.000 5.57 0.00 0.00 6.13
831 832 0.904649 TCCATCAGACGGCTGTTCAT 59.095 50.000 19.93 0.71 42.84 2.57
891 892 1.153086 GCTCTCGGCCATTCCACAT 60.153 57.895 2.24 0.00 34.27 3.21
934 935 6.127225 TGGTTATCTGAAGTGGATTCTCTCTG 60.127 42.308 0.00 0.00 38.83 3.35
969 970 4.031129 CCTGCTGCTCAGTGGGCT 62.031 66.667 17.64 0.00 41.25 5.19
998 999 1.065418 CGCTACATGGACCCCTTTCTT 60.065 52.381 0.00 0.00 0.00 2.52
1377 1382 0.249031 GTGCTTTCCTGTGTTGCACC 60.249 55.000 0.00 0.00 45.52 5.01
1378 1383 0.682532 TGCTTTCCTGTGTTGCACCA 60.683 50.000 0.00 0.00 32.73 4.17
1432 1437 3.316573 CTTTCTTCCTCCCGCGCCT 62.317 63.158 0.00 0.00 0.00 5.52
1600 1605 3.378112 GCAGAAACGATCCAATCCATTCA 59.622 43.478 0.00 0.00 0.00 2.57
1731 1736 2.297315 TGGAATCATCTCCCGATTCTCG 59.703 50.000 11.47 0.00 45.31 4.04
1873 1886 3.576648 AGATCTTCGTCACGGACTTTTC 58.423 45.455 0.00 0.00 0.00 2.29
2026 2045 7.639162 AAAGACGAATATTAGTCAATAGGCG 57.361 36.000 24.79 7.66 39.67 5.52
2237 2256 3.114616 CTTGCTCGACACGGCCTG 61.115 66.667 0.00 0.21 0.00 4.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
3 4 0.314935 AAGGCAGTTTTCCATGCACG 59.685 50.000 0.00 0.00 44.37 5.34
676 677 4.943373 TTGAGCCCCAAGAAACCC 57.057 55.556 0.00 0.00 0.00 4.11
692 693 4.538089 GGGGCCCTATCTATTCAATCTCTT 59.462 45.833 24.38 0.00 0.00 2.85
734 735 2.299867 CCTTTTGTGTGAATTCCCCAGG 59.700 50.000 2.27 0.00 0.00 4.45
831 832 1.272490 CAAGCCGAGAGTGGAGTTACA 59.728 52.381 0.00 0.00 0.00 2.41
908 909 6.614906 AGAGAGAATCCACTTCAGATAACCAT 59.385 38.462 0.00 0.00 36.24 3.55
934 935 3.187700 CAGGTTCGGCATCTACTACAAC 58.812 50.000 0.00 0.00 0.00 3.32
978 979 0.541863 AGAAAGGGGTCCATGTAGCG 59.458 55.000 0.00 0.00 0.00 4.26
1079 1081 1.129058 GAAGAAGGCCGAGGGGATAA 58.871 55.000 0.00 0.00 34.06 1.75
1253 1256 1.271856 TTGAGCCTATGTTCACCCGA 58.728 50.000 0.00 0.00 30.81 5.14
2026 2045 2.884639 TGTTTGCTACTGAAAGAAGCCC 59.115 45.455 0.00 0.00 37.43 5.19
2229 2248 1.219935 GGTTAGGGTACAGGCCGTG 59.780 63.158 10.01 5.68 0.00 4.94
2237 2256 0.463204 GCTTCCGAGGGTTAGGGTAC 59.537 60.000 0.00 0.00 0.00 3.34


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.