Multiple sequence alignment - TraesCS1D01G063100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G063100 chr1D 100.000 1633 0 0 599 2231 43234443 43232811 0.000000e+00 3016
1 TraesCS1D01G063100 chr1D 98.042 1634 30 2 599 2231 269409072 269410704 0.000000e+00 2839
2 TraesCS1D01G063100 chr1D 100.000 311 0 0 1 311 43235041 43234731 1.920000e-160 575
3 TraesCS1D01G063100 chr1D 98.392 311 5 0 1 311 269408760 269409070 4.190000e-152 547
4 TraesCS1D01G063100 chr7D 98.836 1633 19 0 599 2231 382052351 382053983 0.000000e+00 2911
5 TraesCS1D01G063100 chr7D 98.715 1634 20 1 599 2231 381971493 381969860 0.000000e+00 2900
6 TraesCS1D01G063100 chr7D 98.592 1633 23 0 599 2231 381926273 381927905 0.000000e+00 2889
7 TraesCS1D01G063100 chr7D 98.286 1634 21 5 599 2231 203502271 203503898 0.000000e+00 2856
8 TraesCS1D01G063100 chr7D 98.714 311 4 0 1 311 381971810 381971500 9.000000e-154 553
9 TraesCS1D01G063100 chr7D 98.392 311 5 0 1 311 381925961 381926271 4.190000e-152 547
10 TraesCS1D01G063100 chr7D 98.392 311 5 0 1 311 382052039 382052349 4.190000e-152 547
11 TraesCS1D01G063100 chr7D 100.000 55 0 0 2172 2226 606916351 606916297 3.920000e-18 102
12 TraesCS1D01G063100 chr7D 96.774 62 1 1 2171 2231 626693989 626693928 3.920000e-18 102
13 TraesCS1D01G063100 chr6D 98.716 1635 19 2 599 2231 124519794 124521428 0.000000e+00 2902
14 TraesCS1D01G063100 chr6D 98.044 1636 29 1 599 2231 458900454 458902089 0.000000e+00 2841
15 TraesCS1D01G063100 chr6D 97.857 1633 35 0 599 2231 168758162 168759794 0.000000e+00 2822
16 TraesCS1D01G063100 chr5A 98.428 1590 25 0 599 2188 238820536 238818947 0.000000e+00 2798
17 TraesCS1D01G063100 chr5A 98.392 311 5 0 1 311 19246883 19246573 4.190000e-152 547
18 TraesCS1D01G063100 chrUn 98.714 311 4 0 1 311 434805530 434805840 9.000000e-154 553
19 TraesCS1D01G063100 chr7A 98.392 311 5 0 1 311 60281273 60281583 4.190000e-152 547
20 TraesCS1D01G063100 chr4D 98.392 311 5 0 1 311 123337431 123337741 4.190000e-152 547
21 TraesCS1D01G063100 chr4D 98.071 311 6 0 1 311 123551886 123552196 1.950000e-150 542
22 TraesCS1D01G063100 chr3A 98.361 61 1 0 2171 2231 227648530 227648590 8.420000e-20 108


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G063100 chr1D 43232811 43235041 2230 True 1795.5 3016 100.0000 1 2231 2 chr1D.!!$R1 2230
1 TraesCS1D01G063100 chr1D 269408760 269410704 1944 False 1693.0 2839 98.2170 1 2231 2 chr1D.!!$F1 2230
2 TraesCS1D01G063100 chr7D 203502271 203503898 1627 False 2856.0 2856 98.2860 599 2231 1 chr7D.!!$F1 1632
3 TraesCS1D01G063100 chr7D 382052039 382053983 1944 False 1729.0 2911 98.6140 1 2231 2 chr7D.!!$F3 2230
4 TraesCS1D01G063100 chr7D 381969860 381971810 1950 True 1726.5 2900 98.7145 1 2231 2 chr7D.!!$R3 2230
5 TraesCS1D01G063100 chr7D 381925961 381927905 1944 False 1718.0 2889 98.4920 1 2231 2 chr7D.!!$F2 2230
6 TraesCS1D01G063100 chr6D 124519794 124521428 1634 False 2902.0 2902 98.7160 599 2231 1 chr6D.!!$F1 1632
7 TraesCS1D01G063100 chr6D 458900454 458902089 1635 False 2841.0 2841 98.0440 599 2231 1 chr6D.!!$F3 1632
8 TraesCS1D01G063100 chr6D 168758162 168759794 1632 False 2822.0 2822 97.8570 599 2231 1 chr6D.!!$F2 1632
9 TraesCS1D01G063100 chr5A 238818947 238820536 1589 True 2798.0 2798 98.4280 599 2188 1 chr5A.!!$R2 1589

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
19 20 0.976641 AGAACAGCGAAGTCCATCCA 59.023 50.0 0.0 0.0 0.0 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1868 1881 3.416156 GGACTTTGATCCAACTTCAGCT 58.584 45.455 0.0 0.0 38.77 4.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
19 20 0.976641 AGAACAGCGAAGTCCATCCA 59.023 50.000 0.00 0.00 0.00 3.41
623 629 2.482296 AAACGGCTCTGCTGCAATGC 62.482 55.000 15.29 15.29 38.71 3.56
779 785 2.568509 CAGAACATTGGGGGCTTCAATT 59.431 45.455 3.78 0.00 33.08 2.32
1070 1077 3.059800 GGTTCCTTTTTCGTCTCGACAAG 60.060 47.826 0.00 0.00 34.89 3.16
1226 1237 1.682394 GGTTCGGAGAGGACTCAGCTA 60.682 57.143 1.75 0.00 44.22 3.32
1454 1465 6.604396 TCATCAAATGGCACTCAGTTCATATT 59.396 34.615 0.00 0.00 30.52 1.28
1868 1881 1.304052 CCTTGCCGTTTCCCCATCA 60.304 57.895 0.00 0.00 0.00 3.07
2014 2027 4.587684 CCCATTACTTCTACCCATCTACGT 59.412 45.833 0.00 0.00 0.00 3.57
2053 2066 0.041238 TGGAACTGAGAGATCCCCGT 59.959 55.000 0.00 0.00 36.44 5.28
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
5 6 0.322546 GGGTTTGGATGGACTTCGCT 60.323 55.000 0.00 0.00 0.00 4.93
19 20 6.665248 CCTCTTATTTCTTCATTGGAGGGTTT 59.335 38.462 0.00 0.00 36.44 3.27
89 90 4.508405 CCCCCACACTTCTTTATTTCTCCA 60.508 45.833 0.00 0.00 0.00 3.86
623 629 1.330655 ACTACGGACCCTCTGCCATG 61.331 60.000 0.00 0.00 0.00 3.66
667 673 4.752594 TAGGCCCCTTCCCGGCTT 62.753 66.667 0.00 0.00 46.24 4.35
764 770 1.185315 CGACAATTGAAGCCCCCAAT 58.815 50.000 13.59 0.00 35.92 3.16
779 785 1.679680 GATGGGGATAACGAGTCGACA 59.320 52.381 21.50 6.41 0.00 4.35
1070 1077 5.703876 AGCGTTTTCAAGATGATTCTTTCC 58.296 37.500 0.00 0.00 40.28 3.13
1454 1465 5.692654 TGTCAATGATCGAACGAACTTACAA 59.307 36.000 0.12 0.00 0.00 2.41
1868 1881 3.416156 GGACTTTGATCCAACTTCAGCT 58.584 45.455 0.00 0.00 38.77 4.24
1965 1978 4.756502 ACGCACCTAAGTTAGAGATTTCC 58.243 43.478 11.66 0.00 0.00 3.13
2014 2027 3.816994 CAATGGCTGGATCTCAGAATCA 58.183 45.455 13.48 8.96 46.18 2.57
2139 2152 2.306341 TAGGGTCTCGAGTACGACTG 57.694 55.000 13.13 0.00 43.81 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.