Multiple sequence alignment - TraesCS1D01G052100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G052100 chr1D 100.000 2441 0 0 1 2441 33122462 33124902 0.000000e+00 4508
1 TraesCS1D01G052100 chr1D 95.949 2444 90 8 1 2441 33178643 33176206 0.000000e+00 3956
2 TraesCS1D01G052100 chr1D 96.560 2064 67 4 1 2061 33113516 33111454 0.000000e+00 3415
3 TraesCS1D01G052100 chr1D 96.296 540 18 2 1902 2441 33170094 33169557 0.000000e+00 885
4 TraesCS1D01G052100 chr1D 95.064 466 22 1 1977 2441 33111488 33111023 0.000000e+00 732
5 TraesCS1D01G052100 chr1D 90.495 505 30 6 1947 2441 437981634 437982130 0.000000e+00 651
6 TraesCS1D01G052100 chr1D 92.077 467 28 4 1976 2441 437998606 437999064 0.000000e+00 649
7 TraesCS1D01G052100 chr2D 93.686 2328 99 20 1 2313 38586489 38588783 0.000000e+00 3441
8 TraesCS1D01G052100 chr2D 93.783 2252 103 14 1 2238 38597771 38599999 0.000000e+00 3349
9 TraesCS1D01G052100 chr2D 87.464 351 18 11 1892 2238 38619434 38619106 4.930000e-102 381
10 TraesCS1D01G052100 chr1A 93.902 2296 100 13 1 2285 513774401 513772135 0.000000e+00 3428
11 TraesCS1D01G052100 chr5D 93.905 2264 83 16 1 2238 407680633 407678399 0.000000e+00 3365
12 TraesCS1D01G052100 chr6D 94.057 2238 92 16 17 2238 349550197 349552409 0.000000e+00 3358
13 TraesCS1D01G052100 chr6D 95.785 1993 70 5 1 1982 82084625 82086614 0.000000e+00 3203
14 TraesCS1D01G052100 chr6D 95.537 1994 71 9 1 1982 82070234 82072221 0.000000e+00 3173
15 TraesCS1D01G052100 chr3D 95.938 1994 65 5 1 1982 47688512 47686523 0.000000e+00 3219
16 TraesCS1D01G052100 chr3D 94.013 1353 65 8 1048 2391 190425971 190424626 0.000000e+00 2036
17 TraesCS1D01G052100 chr3D 92.767 553 39 1 1890 2441 190430133 190429581 0.000000e+00 798
18 TraesCS1D01G052100 chr2B 91.103 1877 130 21 592 2441 68136222 68134356 0.000000e+00 2507
19 TraesCS1D01G052100 chr2B 91.836 1776 123 12 598 2359 68136228 68137995 0.000000e+00 2457


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G052100 chr1D 33122462 33124902 2440 False 4508.0 4508 100.000 1 2441 1 chr1D.!!$F1 2440
1 TraesCS1D01G052100 chr1D 33176206 33178643 2437 True 3956.0 3956 95.949 1 2441 1 chr1D.!!$R2 2440
2 TraesCS1D01G052100 chr1D 33111023 33113516 2493 True 2073.5 3415 95.812 1 2441 2 chr1D.!!$R3 2440
3 TraesCS1D01G052100 chr1D 33169557 33170094 537 True 885.0 885 96.296 1902 2441 1 chr1D.!!$R1 539
4 TraesCS1D01G052100 chr2D 38586489 38588783 2294 False 3441.0 3441 93.686 1 2313 1 chr2D.!!$F1 2312
5 TraesCS1D01G052100 chr2D 38597771 38599999 2228 False 3349.0 3349 93.783 1 2238 1 chr2D.!!$F2 2237
6 TraesCS1D01G052100 chr1A 513772135 513774401 2266 True 3428.0 3428 93.902 1 2285 1 chr1A.!!$R1 2284
7 TraesCS1D01G052100 chr5D 407678399 407680633 2234 True 3365.0 3365 93.905 1 2238 1 chr5D.!!$R1 2237
8 TraesCS1D01G052100 chr6D 349550197 349552409 2212 False 3358.0 3358 94.057 17 2238 1 chr6D.!!$F3 2221
9 TraesCS1D01G052100 chr6D 82084625 82086614 1989 False 3203.0 3203 95.785 1 1982 1 chr6D.!!$F2 1981
10 TraesCS1D01G052100 chr6D 82070234 82072221 1987 False 3173.0 3173 95.537 1 1982 1 chr6D.!!$F1 1981
11 TraesCS1D01G052100 chr3D 47686523 47688512 1989 True 3219.0 3219 95.938 1 1982 1 chr3D.!!$R1 1981
12 TraesCS1D01G052100 chr3D 190424626 190430133 5507 True 1417.0 2036 93.390 1048 2441 2 chr3D.!!$R2 1393
13 TraesCS1D01G052100 chr2B 68134356 68136222 1866 True 2507.0 2507 91.103 592 2441 1 chr2B.!!$R1 1849
14 TraesCS1D01G052100 chr2B 68136228 68137995 1767 False 2457.0 2457 91.836 598 2359 1 chr2B.!!$F1 1761

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
650 653 3.53758 GATGGGGTGCGATACTAAAACA 58.462 45.455 0.0 0.0 0.0 2.83 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2405 5731 0.033504 TCTTCTCCGTCTGGTGTTGC 59.966 55.0 0.0 0.0 36.3 4.17 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
583 586 5.993748 TTTAAAACCCCTAGAATTGCCTG 57.006 39.130 0.00 0.00 0.00 4.85
627 630 5.426689 TTGAGACAGATGCATCTAAGGTT 57.573 39.130 28.27 12.59 34.85 3.50
650 653 3.537580 GATGGGGTGCGATACTAAAACA 58.462 45.455 0.00 0.00 0.00 2.83
715 719 5.260424 TGCAGATATGCTTTGGGAAGTTAA 58.740 37.500 14.34 0.00 35.25 2.01
1140 4361 8.454570 TTGATGAAGCTCAAAGATGCATATTA 57.545 30.769 7.05 0.00 32.35 0.98
1171 4392 6.485830 TCTGGTTCCAATATACTCTCAAGG 57.514 41.667 0.00 0.00 0.00 3.61
1433 4664 1.960689 GCCTTACTTTGGGCAAGAACA 59.039 47.619 0.00 0.00 46.84 3.18
1434 4665 2.364002 GCCTTACTTTGGGCAAGAACAA 59.636 45.455 0.00 0.00 46.84 2.83
1515 4746 2.985896 GCATACCTGCTTCACCAACTA 58.014 47.619 0.00 0.00 45.32 2.24
1540 4771 0.624500 AAGGGGGAGGCATCAAGCTA 60.625 55.000 0.00 0.00 44.79 3.32
1815 5061 7.626390 TGATGATGATCATATGGACATAGCAA 58.374 34.615 8.54 0.00 37.20 3.91
1881 5127 8.862325 TTGATATTGCTATCAATTATTCGGGT 57.138 30.769 4.69 0.00 45.23 5.28
2135 5460 1.208052 AGCTCTGAAGGCTAATCGCAA 59.792 47.619 0.00 0.00 41.67 4.85
2136 5461 2.158842 AGCTCTGAAGGCTAATCGCAAT 60.159 45.455 0.00 0.00 41.67 3.56
2171 5496 1.986378 CGAAGAGCAAAGACTGGTACG 59.014 52.381 0.00 0.00 35.35 3.67
2191 5516 1.233019 CAGAGGCCAGCCAATTATCG 58.767 55.000 12.03 0.00 38.92 2.92
2308 5633 0.541392 TAGAGGGACACGCATGCATT 59.459 50.000 19.57 0.00 0.00 3.56
2349 5675 1.078143 GTGCATTCTCCCGGAAGCT 60.078 57.895 0.73 0.00 37.36 3.74
2376 5702 0.313672 GAGGTGCTCTCTCGCCTATG 59.686 60.000 0.00 0.00 46.22 2.23
2404 5730 2.935201 GACATTTGCTGCGAAGAGAGAT 59.065 45.455 8.49 0.00 0.00 2.75
2405 5731 2.676839 ACATTTGCTGCGAAGAGAGATG 59.323 45.455 8.49 3.10 0.00 2.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
539 542 6.983906 AATTCTTGACCTTTTCCTTGATGT 57.016 33.333 0.00 0.0 0.00 3.06
627 630 1.796017 TTAGTATCGCACCCCATCCA 58.204 50.000 0.00 0.0 0.00 3.41
1250 4480 5.309323 TGGTATTTCAATCTTTTCTGGCG 57.691 39.130 0.00 0.0 0.00 5.69
1515 4746 2.155197 GATGCCTCCCCCTTTGTGGT 62.155 60.000 0.00 0.0 0.00 4.16
2135 5460 3.305720 TCTTCGGCCATACAGGTCTTAT 58.694 45.455 2.24 0.0 40.99 1.73
2136 5461 2.693591 CTCTTCGGCCATACAGGTCTTA 59.306 50.000 2.24 0.0 40.99 2.10
2171 5496 0.957362 GATAATTGGCTGGCCTCTGC 59.043 55.000 13.05 5.8 36.94 4.26
2191 5516 0.741221 GTGGGCATTGTCTCTCCGTC 60.741 60.000 0.00 0.0 0.00 4.79
2238 5563 3.815401 CCCGACAAACTTCAATCTTCAGT 59.185 43.478 0.00 0.0 0.00 3.41
2360 5686 2.468831 CTTTCATAGGCGAGAGAGCAC 58.531 52.381 0.00 0.0 39.27 4.40
2376 5702 1.806542 TCGCAGCAAATGTCTCCTTTC 59.193 47.619 0.00 0.0 0.00 2.62
2404 5730 0.249868 CTTCTCCGTCTGGTGTTGCA 60.250 55.000 0.00 0.0 36.30 4.08
2405 5731 0.033504 TCTTCTCCGTCTGGTGTTGC 59.966 55.000 0.00 0.0 36.30 4.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.