Multiple sequence alignment - TraesCS1D01G050700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G050700 chr1D 100.000 3010 0 0 1 3010 30821124 30824133 0.000000e+00 5559
1 TraesCS1D01G050700 chr1D 99.037 3010 29 0 1 3010 30880064 30883073 0.000000e+00 5398
2 TraesCS1D01G050700 chr1D 99.132 2189 19 0 822 3010 30704730 30706918 0.000000e+00 3938
3 TraesCS1D01G050700 chr1D 99.040 2188 20 1 823 3010 30777545 30779731 0.000000e+00 3923
4 TraesCS1D01G050700 chr1D 98.068 1863 33 3 1143 3005 30934140 30935999 0.000000e+00 3238
5 TraesCS1D01G050700 chr1D 98.755 1446 17 1 1565 3010 30848829 30850273 0.000000e+00 2569
6 TraesCS1D01G050700 chr1D 98.686 1446 18 1 1565 3010 30723645 30725089 0.000000e+00 2564
7 TraesCS1D01G050700 chr1D 99.478 1149 6 0 1 1149 30925381 30926529 0.000000e+00 2089
8 TraesCS1D01G050700 chr1D 96.355 823 22 1 1 823 30776671 30777485 0.000000e+00 1347
9 TraesCS1D01G050700 chr1D 98.884 448 5 0 376 823 30704224 30704671 0.000000e+00 800
10 TraesCS1D01G050700 chr1D 98.886 359 4 0 1209 1567 30709598 30709956 2.530000e-180 641
11 TraesCS1D01G050700 chr1D 96.296 378 14 0 1 378 30703218 30703595 3.300000e-174 621
12 TraesCS1D01G050700 chr1D 97.772 359 6 1 1209 1567 30834754 30835110 4.260000e-173 617
13 TraesCS1D01G050700 chr6D 89.100 211 21 2 2796 3005 469024204 469023995 8.280000e-66 261
14 TraesCS1D01G050700 chr7A 88.725 204 22 1 2796 2999 378986405 378986607 6.440000e-62 248
15 TraesCS1D01G050700 chr5A 88.293 205 22 2 2796 2999 538845254 538845457 8.340000e-61 244


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G050700 chr1D 30821124 30824133 3009 False 5559 5559 100.0000 1 3010 1 chr1D.!!$F2 3009
1 TraesCS1D01G050700 chr1D 30880064 30883073 3009 False 5398 5398 99.0370 1 3010 1 chr1D.!!$F5 3009
2 TraesCS1D01G050700 chr1D 30934140 30935999 1859 False 3238 3238 98.0680 1143 3005 1 chr1D.!!$F7 1862
3 TraesCS1D01G050700 chr1D 30776671 30779731 3060 False 2635 3923 97.6975 1 3010 2 chr1D.!!$F9 3009
4 TraesCS1D01G050700 chr1D 30848829 30850273 1444 False 2569 2569 98.7550 1565 3010 1 chr1D.!!$F4 1445
5 TraesCS1D01G050700 chr1D 30723645 30725089 1444 False 2564 2564 98.6860 1565 3010 1 chr1D.!!$F1 1445
6 TraesCS1D01G050700 chr1D 30925381 30926529 1148 False 2089 2089 99.4780 1 1149 1 chr1D.!!$F6 1148
7 TraesCS1D01G050700 chr1D 30703218 30709956 6738 False 1500 3938 98.2995 1 3010 4 chr1D.!!$F8 3009

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
256 257 7.870509 ATGTTGACAATCTATAACTGCACAT 57.129 32.0 0.0 0.0 0.0 3.21 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2591 3291 6.421202 CGAGAGGTAATTTGAGTAACATAGCC 59.579 42.308 0.0 0.0 0.0 3.93 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
256 257 7.870509 ATGTTGACAATCTATAACTGCACAT 57.129 32.000 0.00 0.0 0.00 3.21
2719 3419 4.412199 CCAGTCTAAAGGGGGTGATTCATA 59.588 45.833 0.00 0.0 0.00 2.15
2853 3553 6.045318 AGAACACTCATGTATGTGATGCTAC 58.955 40.000 17.87 0.0 38.45 3.58
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
256 257 6.222038 ACTTCTGCTCACGGAGAAATAATA 57.778 37.500 5.24 0.0 45.26 0.98
2591 3291 6.421202 CGAGAGGTAATTTGAGTAACATAGCC 59.579 42.308 0.00 0.0 0.00 3.93
2719 3419 8.669055 AATGGCCACCATAATATGATAACAAT 57.331 30.769 8.16 0.0 44.40 2.71
2853 3553 6.735130 AGTTTTTGGTTAAGACGAATCTTGG 58.265 36.000 0.00 0.0 45.17 3.61


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.